ID: 931704238

View in Genome Browser
Species Human (GRCh38)
Location 2:64934009-64934031
Sequence TAGTGGCATACACACAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704238_931704250 29 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704238_931704246 7 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704246 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
931704238_931704248 19 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704238_931704251 30 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704238_931704240 -10 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704240 2:64934022-64934044 TATGCCACTAACCTTTCCCAGGG No data
931704238_931704247 15 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704247 2:64934047-64934069 TGCTGGTCAACCAGGAGAGCAGG No data
931704238_931704242 -2 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704242 2:64934030-64934052 TAACCTTTCCCAGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704238 Original CRISPR TAGTGGCATACACACAGCCC TGG (reversed) Intergenic
No off target data available for this crispr