ID: 931704241

View in Genome Browser
Species Human (GRCh38)
Location 2:64934026-64934048
Sequence CACTCCCTGGGAAAGGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704241_931704252 14 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704252 2:64934063-64934085 GAGCAGGCTGGATGTTGTAGGGG No data
931704241_931704251 13 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704241_931704246 -10 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704246 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
931704241_931704248 2 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704241_931704247 -2 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704247 2:64934047-64934069 TGCTGGTCAACCAGGAGAGCAGG No data
931704241_931704250 12 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704241 Original CRISPR CACTCCCTGGGAAAGGTTAG TGG (reversed) Intergenic
No off target data available for this crispr