ID: 931704243

View in Genome Browser
Species Human (GRCh38)
Location 2:64934033-64934055
Sequence TGACCAGCACTCCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704243_931704248 -5 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704243_931704251 6 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704243_931704247 -9 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704247 2:64934047-64934069 TGCTGGTCAACCAGGAGAGCAGG No data
931704243_931704250 5 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704243_931704253 24 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data
931704243_931704252 7 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704252 2:64934063-64934085 GAGCAGGCTGGATGTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704243 Original CRISPR TGACCAGCACTCCCTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr