ID: 931704245

View in Genome Browser
Species Human (GRCh38)
Location 2:64934039-64934061
Sequence CCTGGTTGACCAGCACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704245_931704251 0 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704245_931704256 28 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704256 2:64934090-64934112 CTGCCTCTCCAGGCAGCAGCAGG No data
931704245_931704252 1 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704252 2:64934063-64934085 GAGCAGGCTGGATGTTGTAGGGG No data
931704245_931704253 18 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data
931704245_931704250 -1 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704245 Original CRISPR CCTGGTTGACCAGCACTCCC TGG (reversed) Intergenic
No off target data available for this crispr