ID: 931704248

View in Genome Browser
Species Human (GRCh38)
Location 2:64934051-64934073
Sequence GGTCAACCAGGAGAGCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704243_931704248 -5 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704237_931704248 20 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704244_931704248 -10 Left 931704244 2:64934038-64934060 CCCAGGGAGTGCTGGTCAACCAG No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704238_931704248 19 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704241_931704248 2 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704248 Original CRISPR GGTCAACCAGGAGAGCAGGC TGG Intergenic
No off target data available for this crispr