ID: 931704250

View in Genome Browser
Species Human (GRCh38)
Location 2:64934061-64934083
Sequence GAGAGCAGGCTGGATGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704244_931704250 0 Left 931704244 2:64934038-64934060 CCCAGGGAGTGCTGGTCAACCAG No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704243_931704250 5 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704245_931704250 -1 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704241_931704250 12 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704238_931704250 29 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704237_931704250 30 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704250 Original CRISPR GAGAGCAGGCTGGATGTTGT AGG Intergenic
No off target data available for this crispr