ID: 931704251

View in Genome Browser
Species Human (GRCh38)
Location 2:64934062-64934084
Sequence AGAGCAGGCTGGATGTTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704238_931704251 30 Left 931704238 2:64934009-64934031 CCAGGGCTGTGTGTATGCCACTA No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704244_931704251 1 Left 931704244 2:64934038-64934060 CCCAGGGAGTGCTGGTCAACCAG No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704243_931704251 6 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704245_931704251 0 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data
931704241_931704251 13 Left 931704241 2:64934026-64934048 CCACTAACCTTTCCCAGGGAGTG No data
Right 931704251 2:64934062-64934084 AGAGCAGGCTGGATGTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704251 Original CRISPR AGAGCAGGCTGGATGTTGTA GGG Intergenic
No off target data available for this crispr