ID: 931704253

View in Genome Browser
Species Human (GRCh38)
Location 2:64934080-64934102
Sequence TAGGGGAGCCCTGCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704249_931704253 0 Left 931704249 2:64934057-64934079 CCAGGAGAGCAGGCTGGATGTTG No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data
931704245_931704253 18 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data
931704243_931704253 24 Left 931704243 2:64934033-64934055 CCTTTCCCAGGGAGTGCTGGTCA No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data
931704244_931704253 19 Left 931704244 2:64934038-64934060 CCCAGGGAGTGCTGGTCAACCAG No data
Right 931704253 2:64934080-64934102 TAGGGGAGCCCTGCCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704253 Original CRISPR TAGGGGAGCCCTGCCTCTCC AGG Intergenic
No off target data available for this crispr