ID: 931704256

View in Genome Browser
Species Human (GRCh38)
Location 2:64934090-64934112
Sequence CTGCCTCTCCAGGCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704244_931704256 29 Left 931704244 2:64934038-64934060 CCCAGGGAGTGCTGGTCAACCAG No data
Right 931704256 2:64934090-64934112 CTGCCTCTCCAGGCAGCAGCAGG No data
931704245_931704256 28 Left 931704245 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
Right 931704256 2:64934090-64934112 CTGCCTCTCCAGGCAGCAGCAGG No data
931704249_931704256 10 Left 931704249 2:64934057-64934079 CCAGGAGAGCAGGCTGGATGTTG No data
Right 931704256 2:64934090-64934112 CTGCCTCTCCAGGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704256 Original CRISPR CTGCCTCTCCAGGCAGCAGC AGG Intergenic
No off target data available for this crispr