ID: 931704300

View in Genome Browser
Species Human (GRCh38)
Location 2:64934450-64934472
Sequence ATTTTTACACAGAAGAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704300_931704302 -1 Left 931704300 2:64934450-64934472 CCTAGATTCTTCTGTGTAAAAAT No data
Right 931704302 2:64934472-64934494 TGGAGACTTCATTTTGCCCTTGG No data
931704300_931704303 9 Left 931704300 2:64934450-64934472 CCTAGATTCTTCTGTGTAAAAAT No data
Right 931704303 2:64934482-64934504 ATTTTGCCCTTGGCTTGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704300 Original CRISPR ATTTTTACACAGAAGAATCT AGG (reversed) Intergenic
No off target data available for this crispr