ID: 931704758

View in Genome Browser
Species Human (GRCh38)
Location 2:64938096-64938118
Sequence CGCCCACTTCACCCATGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704758_931704764 0 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704764 2:64938119-64938141 GGCTCTGACCAGAGTGCCAGGGG No data
931704758_931704762 -2 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704762 2:64938117-64938139 CGGGCTCTGACCAGAGTGCCAGG No data
931704758_931704767 12 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704767 2:64938131-64938153 AGTGCCAGGGGTGCCATCCCGGG No data
931704758_931704766 11 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704766 2:64938130-64938152 GAGTGCCAGGGGTGCCATCCCGG No data
931704758_931704763 -1 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704763 2:64938118-64938140 GGGCTCTGACCAGAGTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704758 Original CRISPR CGCCCACTTCACCCATGGCC TGG (reversed) Intergenic