ID: 931704761

View in Genome Browser
Species Human (GRCh38)
Location 2:64938101-64938123
Sequence GAGCCCGCCCACTTCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704761_931704762 -7 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704762 2:64938117-64938139 CGGGCTCTGACCAGAGTGCCAGG No data
931704761_931704763 -6 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704763 2:64938118-64938140 GGGCTCTGACCAGAGTGCCAGGG No data
931704761_931704766 6 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704766 2:64938130-64938152 GAGTGCCAGGGGTGCCATCCCGG No data
931704761_931704767 7 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704767 2:64938131-64938153 AGTGCCAGGGGTGCCATCCCGGG No data
931704761_931704764 -5 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704764 2:64938119-64938141 GGCTCTGACCAGAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704761 Original CRISPR GAGCCCGCCCACTTCACCCA TGG (reversed) Intergenic
No off target data available for this crispr