ID: 931704764

View in Genome Browser
Species Human (GRCh38)
Location 2:64938119-64938141
Sequence GGCTCTGACCAGAGTGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704761_931704764 -5 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704764 2:64938119-64938141 GGCTCTGACCAGAGTGCCAGGGG No data
931704755_931704764 9 Left 931704755 2:64938087-64938109 CCAGCTGGGCCAGGCCATGGGTG No data
Right 931704764 2:64938119-64938141 GGCTCTGACCAGAGTGCCAGGGG No data
931704758_931704764 0 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704764 2:64938119-64938141 GGCTCTGACCAGAGTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704764 Original CRISPR GGCTCTGACCAGAGTGCCAG GGG Intergenic