ID: 931704766

View in Genome Browser
Species Human (GRCh38)
Location 2:64938130-64938152
Sequence GAGTGCCAGGGGTGCCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704755_931704766 20 Left 931704755 2:64938087-64938109 CCAGCTGGGCCAGGCCATGGGTG No data
Right 931704766 2:64938130-64938152 GAGTGCCAGGGGTGCCATCCCGG No data
931704758_931704766 11 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704766 2:64938130-64938152 GAGTGCCAGGGGTGCCATCCCGG No data
931704761_931704766 6 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704766 2:64938130-64938152 GAGTGCCAGGGGTGCCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704766 Original CRISPR GAGTGCCAGGGGTGCCATCC CGG Intergenic
No off target data available for this crispr