ID: 931704767

View in Genome Browser
Species Human (GRCh38)
Location 2:64938131-64938153
Sequence AGTGCCAGGGGTGCCATCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704758_931704767 12 Left 931704758 2:64938096-64938118 CCAGGCCATGGGTGAAGTGGGCG No data
Right 931704767 2:64938131-64938153 AGTGCCAGGGGTGCCATCCCGGG No data
931704761_931704767 7 Left 931704761 2:64938101-64938123 CCATGGGTGAAGTGGGCGGGCTC No data
Right 931704767 2:64938131-64938153 AGTGCCAGGGGTGCCATCCCGGG No data
931704755_931704767 21 Left 931704755 2:64938087-64938109 CCAGCTGGGCCAGGCCATGGGTG No data
Right 931704767 2:64938131-64938153 AGTGCCAGGGGTGCCATCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704767 Original CRISPR AGTGCCAGGGGTGCCATCCC GGG Intergenic