ID: 931706104

View in Genome Browser
Species Human (GRCh38)
Location 2:64947764-64947786
Sequence CATTATGGACAAATGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931706104_931706107 -6 Left 931706104 2:64947764-64947786 CCCTGCTTCATTTGTCCATAATG No data
Right 931706107 2:64947781-64947803 ATAATGTTTAAAACCCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931706104 Original CRISPR CATTATGGACAAATGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr