ID: 931706660

View in Genome Browser
Species Human (GRCh38)
Location 2:64951850-64951872
Sequence TCCAGGGATGGGGCTACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931706650_931706660 12 Left 931706650 2:64951815-64951837 CCTCAGACTCTGGTTCCATGGAG No data
Right 931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG No data
931706647_931706660 26 Left 931706647 2:64951801-64951823 CCTAGGATCAGGTTCCTCAGACT No data
Right 931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG No data
931706653_931706660 -3 Left 931706653 2:64951830-64951852 CCATGGAGATGGAGGCCTGCTCC No data
Right 931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931706660 Original CRISPR TCCAGGGATGGGGCTACACT AGG Intergenic
No off target data available for this crispr