ID: 931706705

View in Genome Browser
Species Human (GRCh38)
Location 2:64952215-64952237
Sequence CTGTGGGACCCAGAGAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931706695_931706705 16 Left 931706695 2:64952176-64952198 CCCTTTACTACAAGAAAGTCTTC No data
Right 931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG No data
931706700_931706705 -6 Left 931706700 2:64952198-64952220 CCAGTACCTTGTGGGGTCTGTGG No data
Right 931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG No data
931706696_931706705 15 Left 931706696 2:64952177-64952199 CCTTTACTACAAGAAAGTCTTCC No data
Right 931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931706705 Original CRISPR CTGTGGGACCCAGAGAAAGT GGG Intergenic
No off target data available for this crispr