ID: 931707443

View in Genome Browser
Species Human (GRCh38)
Location 2:64958821-64958843
Sequence GTTGAAATGAAGAGAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931707436_931707443 21 Left 931707436 2:64958777-64958799 CCTGCAGGGTGGCTTCAGCTTGG No data
Right 931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931707443 Original CRISPR GTTGAAATGAAGAGAGAACC AGG Intergenic
No off target data available for this crispr