ID: 931710002 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:64980712-64980734 |
| Sequence | CTACAGCCATAGGTGGACCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931710002_931710006 | 16 | Left | 931710002 | 2:64980712-64980734 | CCTAGGTCCACCTATGGCTGTAG | No data | ||
| Right | 931710006 | 2:64980751-64980773 | TCATTTGTCATGTGTGCCCTTGG | No data | ||||
| 931710002_931710007 | 29 | Left | 931710002 | 2:64980712-64980734 | CCTAGGTCCACCTATGGCTGTAG | No data | ||
| Right | 931710007 | 2:64980764-64980786 | GTGCCCTTGGAGAAAACGAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931710002 | Original CRISPR | CTACAGCCATAGGTGGACCT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||