ID: 931710002

View in Genome Browser
Species Human (GRCh38)
Location 2:64980712-64980734
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931710002_931710006 16 Left 931710002 2:64980712-64980734 CCTAGGTCCACCTATGGCTGTAG No data
Right 931710006 2:64980751-64980773 TCATTTGTCATGTGTGCCCTTGG No data
931710002_931710007 29 Left 931710002 2:64980712-64980734 CCTAGGTCCACCTATGGCTGTAG No data
Right 931710007 2:64980764-64980786 GTGCCCTTGGAGAAAACGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931710002 Original CRISPR CTACAGCCATAGGTGGACCT AGG (reversed) Intergenic
No off target data available for this crispr