ID: 931716354

View in Genome Browser
Species Human (GRCh38)
Location 2:65032198-65032220
Sequence AGCCTTCCACGTTATAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931716354_931716357 6 Left 931716354 2:65032198-65032220 CCTCCCTTATAACGTGGAAGGCT No data
Right 931716357 2:65032227-65032249 AACTTTTGCACTTTTTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931716354 Original CRISPR AGCCTTCCACGTTATAAGGG AGG (reversed) Intergenic
No off target data available for this crispr