ID: 931723498

View in Genome Browser
Species Human (GRCh38)
Location 2:65085396-65085418
Sequence CTGAATAAGGTGAGACTAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931723492_931723498 30 Left 931723492 2:65085343-65085365 CCAAGAAAGTACTACCTTACCTA 0: 1
1: 0
2: 1
3: 8
4: 116
Right 931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 194
931723493_931723498 16 Left 931723493 2:65085357-65085379 CCTTACCTAGAGATGATCTAAGA 0: 1
1: 0
2: 0
3: 11
4: 113
Right 931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 194
931723494_931723498 11 Left 931723494 2:65085362-65085384 CCTAGAGATGATCTAAGATATTT 0: 1
1: 0
2: 2
3: 23
4: 317
Right 931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931723498 Original CRISPR CTGAATAAGGTGAGACTAAA GGG Exonic
909347803 1:74612749-74612771 AGGAAAAAGGTGAGACTGAAGGG + Exonic
910507841 1:87970532-87970554 GTGAATAAGGATAGACTAAAAGG + Intergenic
910649506 1:89550470-89550492 CTGAAGAAGGTGAGATGAAAAGG - Intronic
913352967 1:117882733-117882755 CTAAATAAGATGAGATTTAATGG + Intronic
913697696 1:121343701-121343723 CTGAACAAGGTGTGACTCTAAGG - Intronic
914139860 1:144936350-144936372 CTGAACAAGGTGTGACTCTAAGG + Intronic
916305836 1:163331133-163331155 CTTAATAATGAAAGACTAAATGG - Intronic
917410093 1:174750385-174750407 CTGACTAAGCTGGGACCAAAGGG - Intronic
918642503 1:186860427-186860449 CTCAGTGAGGTGAGAATAAATGG + Intronic
918708501 1:187697683-187697705 CTGAACAAAGTAAGACTAAGAGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920292306 1:204932047-204932069 CAGAATAAGGGGATACTATAAGG + Intronic
920485088 1:206362351-206362373 CTGAACAAGGTGTGACTCTAAGG - Intronic
921961042 1:221034645-221034667 GTGAATAAGGAGAGTCTAGAGGG + Intergenic
921974518 1:221187462-221187484 CTGGCTAAGGTGAGAATAAAAGG + Intergenic
923907720 1:238403916-238403938 CTGAAAAGGGTGAAACTGAAAGG - Intergenic
1064593873 10:16923268-16923290 ATTAATCAGGTGAGAATAAAAGG + Intronic
1065642434 10:27797851-27797873 CTTAATAAGGAGAAAATAAATGG + Intergenic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068367743 10:56072969-56072991 CTGAATAAGCTTAGAAAAAATGG - Intergenic
1068418511 10:56758845-56758867 CTAACCAAGATGAGACTAAAAGG + Intergenic
1068869859 10:61931165-61931187 CTCAATAAGTTGAGTGTAAAGGG - Intronic
1070527360 10:77306762-77306784 CTGAACTAGGTAAGAATAAATGG + Intronic
1071060273 10:81561942-81561964 AGAAATAAGGTGAGACCAAATGG - Intergenic
1071901857 10:90128996-90129018 CTGAGAATGTTGAGACTAAAGGG + Intergenic
1072528759 10:96298301-96298323 CTGAAGAATGTGAGGATAAATGG + Intergenic
1072733303 10:97862838-97862860 TTGAATAAGGTGAGACCCAAGGG + Intronic
1074125371 10:110524934-110524956 ATGAAGAAGGAGAGACAAAATGG + Intergenic
1074673882 10:115826516-115826538 CTGCAGGAGGTGAGAGTAAAAGG - Intronic
1075498336 10:122947970-122947992 CTGAAGAAAGTGAGACTACAAGG - Intronic
1078154516 11:8787746-8787768 CTGAAGGAGATGAGATTAAAAGG - Intronic
1079274881 11:19026047-19026069 AAGAATAGAGTGAGACTAAATGG - Intergenic
1079646780 11:22873042-22873064 CTAGATAAGGTGTGGCTAAAAGG + Intergenic
1082113963 11:48307752-48307774 CTTGATAAAGTGTGACTAAATGG + Intergenic
1082881929 11:58046343-58046365 CTGACTAAGGTGAGACCAGTGGG + Intronic
1082901051 11:58252610-58252632 TTGAATATGGTGAGAGTTAAGGG + Intergenic
1085169943 11:74441234-74441256 CAGAAGAAGGTGAGATTAAGAGG + Intergenic
1085462604 11:76703321-76703343 CTGTATAAGGTGAGAATACCAGG - Intergenic
1085829044 11:79880167-79880189 CAGAAGAGGGTGAGACTGAAAGG + Intergenic
1087088214 11:94241565-94241587 CTGGAAAAGGTGAGACTCCAGGG + Intergenic
1090912482 11:131133624-131133646 CTGAATGAGGTGATTCTACATGG + Intergenic
1091187721 11:133661547-133661569 CTGTCTAAGGTGAGACTTAGAGG + Intergenic
1092992277 12:13914318-13914340 ATGAAAAAGCTGAGACTAAGAGG - Intronic
1094255404 12:28419264-28419286 TAGAATAAAGTGAGATTAAATGG - Intronic
1095412678 12:41941278-41941300 CTGAATGAGGTGAAGTTAAAGGG + Intergenic
1096078173 12:48817821-48817843 CTGTTTTAGGTGAGCCTAAAGGG - Intronic
1098456736 12:70682490-70682512 CTTAATAAAAAGAGACTAAAAGG - Intronic
1098471024 12:70844350-70844372 CTAAATAAAATAAGACTAAAAGG + Intronic
1098529310 12:71522305-71522327 CTGAATATGGGGAGACAAGATGG + Intronic
1098763725 12:74458225-74458247 CTGAACAATTTGAGATTAAATGG + Intergenic
1101036046 12:100707489-100707511 CTGGATAATGTGAGATAAAATGG + Intergenic
1102225258 12:111224031-111224053 CTGAATAAGGTGGGAGTCATGGG + Intronic
1102720498 12:115012152-115012174 CTGAAGAAGGAGAGAAGAAAAGG - Intergenic
1104377535 12:128278114-128278136 CTGTATACGGTGACCCTAAAAGG + Intronic
1104687410 12:130796591-130796613 CTTAATAAGGTCAGACTACTTGG + Intronic
1107382400 13:39870832-39870854 CAGAATAAGATGTGACCAAAGGG - Intergenic
1107624023 13:42263862-42263884 CTGAAGAAGGGGAGACTCAGAGG - Intergenic
1108721198 13:53134519-53134541 CTAAATAAGGTGAAACACAAAGG - Intergenic
1109663977 13:65505572-65505594 CTAAATAAGGAGAAACTTAATGG - Intergenic
1110471888 13:75869636-75869658 CTTAAAAAGATGAGATTAAAAGG + Intergenic
1111095420 13:83507672-83507694 CTAAATAAGGTGACACAATATGG + Intergenic
1112937882 13:104823931-104823953 CTGAGCAAGGTGAGAATACAAGG - Intergenic
1114340187 14:21735283-21735305 CTGAATCAGATGAGAAGAAAGGG + Intergenic
1115905821 14:38201940-38201962 ATGAATAAGGTGAAAGTAAAAGG - Intergenic
1117133058 14:52705422-52705444 TTGGATAAGGTGAGACCAAATGG + Intergenic
1117969570 14:61238645-61238667 TTGATAAAGGTGAAACTAAACGG - Intronic
1120142904 14:80948095-80948117 CTTGATTAGGTGGGACTAAATGG + Intronic
1121670444 14:95706627-95706649 CTCAATAAACTGAGACTAGAAGG + Intergenic
1125842028 15:42811853-42811875 CCTAATAAGGTGAAACAAAATGG - Intronic
1127953062 15:63828795-63828817 ATGAATAAGATTAAACTAAAGGG + Intronic
1128840920 15:70851357-70851379 GTTAAAAAGGTGAGAATAAAAGG + Intronic
1130406346 15:83605655-83605677 ATGAATAAAGTGAGCCAAAATGG + Intronic
1131206425 15:90452214-90452236 CTGGAGGAGGTGAGACTTAAGGG + Intronic
1131873669 15:96783505-96783527 CTGAAGAAGGGGCGTCTAAAAGG + Exonic
1133713584 16:8426061-8426083 CTGAATAAAGTGAAAGTAAATGG - Intergenic
1135302998 16:21346883-21346905 TTAAATAAGTTGGGACTAAAAGG + Intergenic
1137055173 16:35742307-35742329 TTGAATAAGGTGAGAAGCAAAGG + Intergenic
1137819422 16:51429513-51429535 GTAAATAAGGTGACTCTAAATGG + Intergenic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1144045842 17:11453840-11453862 CTGGAAAAGGTCAGACTATAGGG + Intronic
1145048297 17:19637027-19637049 CTTAATAAAGTGAGAATAGAAGG + Intergenic
1146432071 17:32806846-32806868 CTGAATATGCTGGAACTAAAGGG - Intronic
1149318550 17:55461422-55461444 CTGGAAAAGGTGAAACTATAGGG + Intergenic
1150092971 17:62345965-62345987 TTGAATAAGGTGAGAGATAAGGG + Intergenic
1150362115 17:64545136-64545158 ATGACTAAGTTTAGACTAAATGG + Intronic
1151451145 17:74199070-74199092 CTGAAGATGGTGAGTTTAAAGGG - Intergenic
1151895956 17:76981163-76981185 GTGAATAAGATGAGCCTAATAGG - Intergenic
1157041566 18:44045676-44045698 ATGAACAACCTGAGACTAAAGGG - Intergenic
1158759579 18:60368660-60368682 ATGGTCAAGGTGAGACTAAATGG + Intergenic
1159915542 18:74184289-74184311 CTTAATAAGGTCAGTCTACAAGG + Intergenic
1160877472 19:1303578-1303600 CTGAAAATGGTGAGATTACAGGG - Intergenic
1161712315 19:5855850-5855872 TTGAATAAGGTGAGAAGCAAAGG - Intergenic
1166638217 19:44470778-44470800 CTGTACATGGTGAGCCTAAAGGG - Intergenic
1167744622 19:51343175-51343197 CTTAATAAGGTGAGACCTGAAGG - Intergenic
926900135 2:17741865-17741887 ATGAATAAGATGAAATTAAATGG + Intronic
926994755 2:18722419-18722441 CTGAGGGAGGTGAGAGTAAATGG + Intergenic
929596125 2:43177385-43177407 CTGGATTAGCTGAGACTACAGGG - Intergenic
931723498 2:65085396-65085418 CTGAATAAGGTGAGACTAAAGGG + Exonic
933558599 2:83863588-83863610 CTGAATTAGCTGAGAGTAGAGGG + Intergenic
935385460 2:102494614-102494636 ATAAATAAGGTGAAAGTAAATGG + Intronic
935498328 2:103808332-103808354 CTGGATAATGGGAGACTACATGG - Intergenic
935696893 2:105778019-105778041 CTGAAGAAGGTGAGGAGAAAAGG - Intronic
936121556 2:109750544-109750566 CTGAATGAGGTTGAACTAAATGG + Intergenic
936223141 2:110620924-110620946 CTGAATGAGGTTGAACTAAATGG - Intergenic
936785688 2:116091564-116091586 TTGAATAAAGTGAGTATAAAAGG - Intergenic
937445897 2:121957572-121957594 ATGAATAAGGTGAGTATTAAGGG + Intergenic
939318364 2:140582051-140582073 CTGAATCAGGTGAGAGAACATGG + Intronic
940841143 2:158583245-158583267 CTGGATACAGTGAGAGTAAAAGG + Intronic
940976642 2:159953288-159953310 CTGAATAAGAAGAGACACAAGGG - Intronic
1169633110 20:7655954-7655976 TTGAGTAAGGAGAGAGTAAAGGG + Intergenic
1171956560 20:31468294-31468316 CTGAATAAGGTGAAAATACGAGG - Intronic
1172313831 20:33938296-33938318 CTGAATGAGATGAGAGCAAACGG - Intergenic
1173786327 20:45795435-45795457 CTGGAGCAGGTGAGACCAAAGGG + Exonic
1177405645 21:20664140-20664162 CTAAGTAAGGAGAGACTAATTGG + Intergenic
1178326521 21:31650439-31650461 CTGAATGAGTTGAGACTCATTGG - Intergenic
1179319753 21:40279199-40279221 TTTTATAAAGTGAGACTAAAAGG + Intronic
1179562267 21:42223097-42223119 TAGAATAAGATGAGACTAGAGGG - Intronic
1181868060 22:25874779-25874801 CTGAAGATGGTGACCCTAAATGG - Intronic
1183093170 22:35537348-35537370 CTTAATGATGTGAGAATAAAAGG + Intergenic
949093237 3:54584-54606 TTTAATAAGGTGAGAAAAAATGG + Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
951748910 3:26012101-26012123 CTGAATAAGGTGCTGTTAAATGG - Intergenic
951764453 3:26181964-26181986 CTGAGAAAGGGGAGACTAAGAGG + Intergenic
955922224 3:63969285-63969307 CAGAATAAGGTGATATAAAAAGG + Intronic
956133815 3:66079352-66079374 GTGAATAGGGTGAGTCTGAAGGG + Intergenic
959346593 3:105202778-105202800 CTAAATAAGGTGAACTTAAAGGG - Intergenic
963317053 3:143771100-143771122 ATGACAAAGGTGAGATTAAAAGG + Intronic
964911502 3:161787938-161787960 CTGAATTATTTGAGACTAAGTGG + Intergenic
965624692 3:170674802-170674824 CTGAATAAGGTGAGAAGCAGAGG + Intronic
968219388 3:196924384-196924406 ATGAATAAGGGGAGGATAAAAGG + Intronic
971509304 4:27404369-27404391 GTAAATAAGCTGTGACTAAAAGG + Intergenic
971732093 4:30397479-30397501 GTGAATAAATTGGGACTAAAAGG + Intergenic
971821462 4:31561021-31561043 CTGCCTTAGGTGAGACAAAATGG - Intergenic
974728717 4:65833284-65833306 CCTAATAAGGTATGACTAAAAGG + Intergenic
975210005 4:71688983-71689005 CAGAATGAGGAGAGACTGAAAGG - Intergenic
975795279 4:78000470-78000492 CTGAATAGGGTGAGAAAGAAAGG - Intergenic
978234014 4:106435861-106435883 CTGAATCAGGTTAGAATTAATGG - Intergenic
978853506 4:113366663-113366685 CTAAATAAAGTGAGAGAAAAAGG - Intronic
979448998 4:120847071-120847093 TGGAATAAGGTTAGAGTAAATGG - Intronic
979776560 4:124595972-124595994 CTGAAAAAGGTGACGCTATAAGG + Intergenic
979983294 4:127283702-127283724 CTGAATTGGGGGAAACTAAAGGG - Intergenic
980078006 4:128314378-128314400 CTGAATAATTTGAGAGTAAGTGG + Intergenic
988651219 5:33153745-33153767 CTGAGAAAGGTGAGAAAAAAAGG + Intergenic
989546678 5:42682608-42682630 GTGATTAAGGAGAAACTAAACGG + Intronic
989558380 5:42823560-42823582 CTGGATAAAGTTTGACTAAAAGG - Intronic
991044869 5:62211986-62212008 CTGAATCAAATGAGACTAAAAGG - Intergenic
992597695 5:78362247-78362269 CTGAATTAGGAAAGGCTAAAAGG - Intronic
995402861 5:111761083-111761105 ATGAATAAACTGAGACTAAAAGG - Intronic
996197109 5:120621965-120621987 CTGAAAAAGGTGACATGAAATGG - Intronic
996409645 5:123144169-123144191 CTGAGGAGGGTGAGACTCAAAGG - Intronic
997883849 5:137613641-137613663 CTGAATCAGATGAGACCACATGG + Intergenic
999005620 5:147974077-147974099 ATGAATAAAGTTACACTAAACGG + Intergenic
999949077 5:156629311-156629333 CATAATAAGGTGATAATAAATGG + Intronic
1001135001 5:169095185-169095207 ATGAATAAGAAGAAACTAAATGG - Intronic
1001171509 5:169423898-169423920 CTCACTAAGGTGGGACTAGATGG - Intergenic
1001888745 5:175320658-175320680 CTTAATAATGAGTGACTAAAGGG - Intergenic
1004116514 6:12773420-12773442 GTGAATCAGGTGAGGCTAGATGG - Intronic
1004209935 6:13629566-13629588 CTAAATAGGGTGACTCTAAATGG + Intronic
1005398912 6:25411692-25411714 ATGAATTAGGTGAAAATAAATGG + Intronic
1006822886 6:36912581-36912603 CTGAAACAGGTGGTACTAAAGGG + Intronic
1007003066 6:38333282-38333304 ATGAATAAGGAAAGACTTAAGGG - Intronic
1007641085 6:43340245-43340267 CTGAAAAAGCTGAAAATAAAAGG - Exonic
1007904928 6:45450234-45450256 CTGAATGATGTGGGACTAGATGG + Intronic
1009689437 6:67009532-67009554 ATGCATCAGGTCAGACTAAACGG + Intergenic
1011844267 6:91543590-91543612 CTGAATGACGGGAGAATAAAAGG + Intergenic
1012361448 6:98386321-98386343 CTGATTATGTTGAGATTAAATGG - Intergenic
1015377973 6:132532228-132532250 CTGAATAAGTTAAGACTTTAGGG + Intergenic
1017756958 6:157537896-157537918 CTGAAGGAGGTGAGACTAATGGG - Intronic
1019207903 6:170377974-170377996 CTGAAGAAGTTGAAACCAAAAGG + Intronic
1022774300 7:33509046-33509068 CTGAATTCGGTGAGATTAGAAGG + Intronic
1030211877 7:107004908-107004930 GTGAAGCAGGTGAGACAAAAAGG + Intergenic
1034214010 7:149389582-149389604 TTACATAAGGTGAGAATAAATGG + Intergenic
1042662640 8:71172293-71172315 CTGAATATGCTGAGAGTAACAGG - Intergenic
1043008406 8:74849924-74849946 ATGAATAAAATGAGACTAAGCGG - Exonic
1045075572 8:98563064-98563086 CTGAAGGAGGTGAGAAGAAAAGG + Intronic
1047994064 8:130316693-130316715 CTGAGGAAGGTGAGATCAAAAGG + Intronic
1048576205 8:135691950-135691972 GAGAATAATGTGAGAATAAATGG - Intergenic
1049123918 8:140768285-140768307 GTGAATAAGCTGAGCCTTAAGGG - Intronic
1050147226 9:2582247-2582269 CTGAAAAAAGTAAGACTAATTGG + Intergenic
1052936490 9:34097594-34097616 CTCAATAAGGTAAGACTTAGTGG + Intronic
1053034614 9:34813920-34813942 CTGAATGAAATGAGAGTAAATGG - Intergenic
1055101932 9:72474927-72474949 CAGAATAAGCTGAAAGTAAAGGG - Intergenic
1057414989 9:94853488-94853510 GTGAGTGAGGTGAGACTGAATGG - Intronic
1059143879 9:111879625-111879647 GTGGAAATGGTGAGACTAAAGGG + Intergenic
1059487498 9:114637950-114637972 ATGAATAAACTGAGACTCAAAGG - Intronic
1060012018 9:120052010-120052032 CTGAATAAACTGAGACCCAAAGG - Intergenic
1060121866 9:120999113-120999135 CTTAGTAAATTGAGACTAAAAGG + Intronic
1060188525 9:121578080-121578102 CTGGCAAAGGAGAGACTAAAGGG - Intronic
1186119895 X:6349275-6349297 CTGAAGAAGGTGAGTGTAAGAGG - Intergenic
1187866729 X:23729597-23729619 CTGAATTATGTGAGAATAAGTGG - Intronic
1188407369 X:29828170-29828192 GAGGATAAGGTGAGACCAAAAGG + Intronic
1189101748 X:38197725-38197747 CTGAAGAAAATGGGACTAAAAGG + Intronic
1189956384 X:46278758-46278780 ATGAATAAGGTTAAACTGAAAGG - Intergenic
1191926984 X:66323697-66323719 TTGAACAAGGTGAGAGAAAATGG - Intergenic
1192797921 X:74439857-74439879 TTAAATGAGGTGAGACAAAAAGG + Intronic
1193283593 X:79685685-79685707 CTGAATAAGGACAGTCTCAATGG - Intergenic
1193653382 X:84167681-84167703 CTGTAAAAGGTAAAACTAAAAGG + Intronic
1196078730 X:111607392-111607414 CACTATAAGGGGAGACTAAAAGG + Intergenic
1196659401 X:118253854-118253876 CTGAAAAAGGTGAGAATATTTGG + Intergenic
1198984442 X:142433490-142433512 CTTCATAAGGTGAGACAAATTGG - Intergenic
1199044291 X:143150708-143150730 TTGTATAAGGTGAGACAAACTGG - Intergenic
1199084339 X:143611382-143611404 CTGGATTAGGTTAGACAAAAAGG - Intergenic
1199903512 X:152201286-152201308 CTTAATAAGCTGGGACAAAAGGG - Intronic
1200051241 X:153432989-153433011 CCAAATAAGGTCACACTAAAAGG + Intergenic
1200130444 X:153840661-153840683 CTTAATAAGCTGGGAATAAAAGG - Intergenic
1200679746 Y:6195920-6195942 CTGAATAATCAGAGACAAAAAGG - Intergenic