ID: 931723949

View in Genome Browser
Species Human (GRCh38)
Location 2:65090685-65090707
Sequence ACATATAGGCAAGAGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931723949 Original CRISPR ACATATAGGCAAGAGTTTGT AGG (reversed) Intronic
904755469 1:32766333-32766355 ACATAGGGACAAGAGTTTATTGG + Intronic
907229960 1:52987933-52987955 CCATATAGCCAAGAATTTCTTGG - Intronic
907434133 1:54433162-54433184 AGATAAAGGCAAGAGTACGTGGG - Intergenic
909135297 1:71791519-71791541 ATATATAGGTAAAAGTTGGTAGG - Intronic
910324203 1:85985842-85985864 GCATATAGGTATAAGTTTGTAGG + Intronic
911111985 1:94198802-94198824 AAATGTTGGCAAGAGTTTTTTGG + Intronic
912011637 1:104972485-104972507 AAATATTAGCAAGAGTTTGTGGG - Intergenic
914329871 1:146657568-146657590 GTACATAGGCAAGAGTTTTTGGG + Intergenic
914382698 1:147132410-147132432 ACATATTTGCAGGAGCTTGTGGG + Intergenic
914893127 1:151645685-151645707 ACATATAGGGAAAAGATTCTAGG - Intronic
915131702 1:153699730-153699752 ACAATTAGGTAAGTGTTTGTTGG + Intergenic
917274422 1:173317014-173317036 ACATATAAGCAATGTTTTGTTGG - Intergenic
917478259 1:175387260-175387282 ACATGGAGGCAAGAGCATGTTGG - Intronic
919297865 1:195723531-195723553 ACATGTGGGAAAGAGTTTCTGGG - Intergenic
921544646 1:216460162-216460184 ACATTTATGGAAGAGTTTCTGGG - Intergenic
922597387 1:226824396-226824418 ACATATGGGAAAGAGTAAGTTGG - Intergenic
923162720 1:231330550-231330572 ACATACAGGGCAGAGGTTGTGGG - Intergenic
1069588442 10:69626952-69626974 ACATATAACCAAGATATTGTGGG + Intergenic
1070074971 10:73126080-73126102 ACATGTAGGCATTTGTTTGTAGG + Intronic
1070688256 10:78505900-78505922 ACATATTGGCAAGAATGTGTAGG + Intergenic
1072976008 10:100058871-100058893 CCATATATGCAAGGGTTTCTGGG - Intronic
1073210227 10:101794809-101794831 ACATAAAGGCAAATGTTTGGAGG + Intronic
1075274703 10:121082825-121082847 TCATATAGGCAAGAAATTGGCGG + Intergenic
1075812871 10:125238762-125238784 TCATACTGGCTAGAGTTTGTAGG - Intergenic
1080120957 11:28676584-28676606 ACATATGGCCAATAGGTTGTTGG - Intergenic
1082171920 11:49015224-49015246 ACATATAGTAGAGAGTTTGAGGG + Intergenic
1084866207 11:72060160-72060182 ACTTATAGGCCATAGTTTGCTGG - Intronic
1087062834 11:93998689-93998711 AGAAATAGGCCAGACTTTGTTGG - Intergenic
1090028492 11:123187406-123187428 AAATATAGGCTTGGGTTTGTGGG - Intronic
1090143150 11:124287777-124287799 AGATATAGCCAAGATTTTCTTGG - Intergenic
1090267889 11:125365156-125365178 ATATATAGGCAAGATTTGGGGGG - Intronic
1090548157 11:127788491-127788513 ACATATAGTAATGAGTTTCTGGG + Intergenic
1091606487 12:1957038-1957060 ACATAAAAGCAAGGTTTTGTAGG - Intronic
1092714378 12:11373448-11373470 AGATCTTGGCAAGAGTTTATTGG - Intronic
1092979995 12:13785009-13785031 ACATAAAAGCAACATTTTGTGGG - Intronic
1095169950 12:39022373-39022395 TCTTGTAGGCAAGAGATTGTTGG - Intergenic
1095415386 12:41971119-41971141 ACCTATAGGGCAGAGTTTGGGGG - Intergenic
1098217380 12:68234740-68234762 CCATAACGGTAAGAGTTTGTAGG - Intergenic
1101496646 12:105260736-105260758 AGCTATAGGCAAGAGGTTCTTGG + Intronic
1103017140 12:117503971-117503993 AAATAGAGGTAAGTGTTTGTGGG - Intronic
1107676500 13:42803123-42803145 ACATATGGGCCAGAATCTGTAGG - Intergenic
1108881666 13:55127392-55127414 ACATATGTGCAAGAATCTGTAGG - Intergenic
1109614470 13:64812176-64812198 ACATATATTCATGAGTTTTTAGG - Intergenic
1110444795 13:75567339-75567361 TCATGTGGGCAAAAGTTTGTGGG + Intronic
1110796204 13:79641082-79641104 ACATAGAGAAAAGAGTATGTGGG - Intergenic
1114776030 14:25482545-25482567 ACAGCTAGGCTAGAGTTTGCTGG - Intergenic
1115151925 14:30295921-30295943 ACTAATAGACAAGAGTTTGGGGG - Intergenic
1116178299 14:41502193-41502215 ATTTATAGACAAGATTTTGTAGG + Intergenic
1116606111 14:46997579-46997601 ACAAATAGGCAGGGGTTAGTGGG - Intronic
1117858457 14:60061660-60061682 AAAAATAGGAAAGAGATTGTAGG - Intronic
1118464277 14:66016682-66016704 ACATATATCTAAGAGTTTATTGG + Intergenic
1119891902 14:78189216-78189238 ACATCTAGGCAAGTGGTGGTGGG - Intergenic
1121405979 14:93719660-93719682 ACAAATAGGCCAGAGGGTGTGGG - Exonic
1125697234 15:41649397-41649419 ACATATAGTCTATAATTTGTAGG + Intronic
1127514524 15:59679281-59679303 ACATATAGTTAACAGTTTGTGGG - Intronic
1128399488 15:67263295-67263317 AAATATAGGCAACATTTTCTTGG + Intronic
1130047803 15:80459828-80459850 ACTAATAGGAATGAGTTTGTAGG + Intronic
1130413856 15:83671811-83671833 ACAGCTAGGCAAGCATTTGTTGG - Intronic
1130747464 15:86671159-86671181 AAATATAAGCAAGAGTGTGCTGG + Intronic
1134099112 16:11439192-11439214 AAATATAGGGTAGAGTTTGGAGG + Intronic
1135434360 16:22416148-22416170 ACAGAGAGGCATGAGGTTGTAGG + Intronic
1137398921 16:48137225-48137247 AAAAATAGCCACGAGTTTGTTGG - Intronic
1138461724 16:57152716-57152738 ACATTTAGGTAAAACTTTGTAGG - Exonic
1138738378 16:59279349-59279371 ACATACAGGCAAGAGATTGACGG - Intergenic
1138912811 16:61422901-61422923 ATAAATAGGCAAGAGTGTGAGGG - Intergenic
1139904323 16:70353041-70353063 ACATGTATGCAAGTGTCTGTAGG + Intronic
1140003684 16:71053346-71053368 GTACATAGGCAAGAGTTTTTGGG - Intronic
1140156689 16:72436141-72436163 ATATAAGGGCAAGAATTTGTGGG - Intergenic
1141388416 16:83644451-83644473 ACATATATGAAAGTCTTTGTAGG + Intronic
1143971559 17:10799660-10799682 ACATATAGGCCAAAGGTCGTAGG + Intergenic
1145001758 17:19310201-19310223 ACATTTAGGAAAGATTTTCTAGG + Intronic
1147840941 17:43371010-43371032 AAATATAGACAAGTGTTTGGAGG + Intergenic
1150310400 17:64124233-64124255 ATATCTAGGAAAGAGATTGTTGG - Intronic
1150932020 17:69595523-69595545 ACAGATAGGCAAGAGTGTAAAGG - Intergenic
1151295279 17:73181189-73181211 ACATCTAGAAAAGACTTTGTAGG - Intergenic
1151709875 17:75797935-75797957 ACATATAGGCAAGACAATGATGG - Intronic
1203168542 17_GL000205v2_random:123175-123197 GCATGCAGGCAAGAGGTTGTAGG + Intergenic
1152991311 18:366286-366308 ACATTTGAGCAAGAGTTTGAGGG + Intronic
1153661051 18:7326736-7326758 CCACATAGGCAAGAGCTTTTAGG + Intergenic
1158762338 18:60404693-60404715 ACATATAGGGAAGAGGATGTGGG - Intergenic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
925959504 2:9002931-9002953 AGACAGAGGCAACAGTTTGTGGG - Intronic
931723949 2:65090685-65090707 ACATATAGGCAAGAGTTTGTAGG - Intronic
932083558 2:68737545-68737567 ACATATAGCCAAGTGTTCCTTGG + Intronic
935127552 2:100237959-100237981 ACATCTAGGGAGGAGGTTGTGGG - Intergenic
935445858 2:103155779-103155801 ACAAATATTCCAGAGTTTGTGGG - Intergenic
939466819 2:142567315-142567337 ACATATAGGGTTGAATTTGTTGG + Intergenic
943600100 2:189907203-189907225 ATATATATGTAAGACTTTGTAGG - Intronic
943608385 2:190003405-190003427 ATATAAATGCAAAAGTTTGTTGG - Intronic
945221344 2:207487697-207487719 ACATATAAGCAAGAGCTCTTTGG + Intergenic
946991050 2:225330065-225330087 ACAAATATGAAAGAGTTTCTGGG - Intergenic
1169686046 20:8273240-8273262 ACATACATGCAAGATTTGGTAGG - Intronic
1173028506 20:39332417-39332439 ACATATATGCAAGGGCTTCTTGG - Intergenic
1175046528 20:56111618-56111640 TCATATAGGCAAAAGTTCTTTGG + Intergenic
1177346765 21:19883207-19883229 ACATATGGGCAATAGTGTGGGGG + Intergenic
1178396066 21:32244776-32244798 ACATTAAGCCAAGAGTTTTTTGG + Intergenic
949389368 3:3542250-3542272 ACATACAGGCAAGAGCATGATGG - Intergenic
949407307 3:3728094-3728116 ACAGATAGCTAAGAGATTGTAGG - Intronic
949774534 3:7617750-7617772 AGAGATAGGAAAGAGTTTGGAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
952620339 3:35331341-35331363 ACTTATAACCAAAAGTTTGTAGG + Intergenic
959737506 3:109676723-109676745 AAATAAAGGCCAAAGTTTGTAGG - Intergenic
960419008 3:117420606-117420628 CCATATAATCAAGAGTTTCTTGG - Intergenic
962341557 3:134589599-134589621 ACATATTGGCAAGGGTGTGGAGG + Intergenic
965331734 3:167383212-167383234 TTTTATAGGCAAAAGTTTGTGGG + Intergenic
970147266 4:13049513-13049535 TGATATAGGCAAGATTTTCTGGG + Intergenic
970209532 4:13694378-13694400 ACACATAGGCAAGAGTGTGAAGG - Intergenic
970295293 4:14623266-14623288 ACAAATGAGCAAGAGTATGTTGG + Intergenic
972199491 4:36696902-36696924 AAATATAGGAAAGAGTCAGTAGG - Intergenic
975962423 4:79928972-79928994 ACATAGAGCTAAGATTTTGTTGG - Intronic
976355468 4:84112200-84112222 AAAAATAGGCAAGAGTCTGCAGG - Intergenic
977498335 4:97805047-97805069 ACATATAGTCATGTGTTGGTTGG - Intronic
977570879 4:98628238-98628260 ACATCTAGACTAGTGTTTGTGGG + Intronic
979405367 4:120304115-120304137 TTATGTAGGCCAGAGTTTGTTGG - Intergenic
983580512 4:169305186-169305208 ATATATAGGGAACAGTGTGTGGG + Intergenic
984033370 4:174633560-174633582 ACATCTAGGCTAGAGTATATGGG - Intergenic
988780879 5:34520911-34520933 ACATATAACCAAGATTTTCTGGG + Intergenic
992838681 5:80666356-80666378 AATTATAGGCAAAATTTTGTTGG - Intronic
993012172 5:82495588-82495610 AGAGAGAGGCAAGAATTTGTAGG + Intergenic
996929101 5:128864835-128864857 GCATTTCGGCATGAGTTTGTTGG + Intronic
999221233 5:149979538-149979560 ACAAAAAGGCAAAAGTTGGTTGG - Intronic
1001817186 5:174679607-174679629 ACATATACTTAATAGTTTGTAGG - Intergenic
1004535109 6:16492827-16492849 GCATATATCCAGGAGTTTGTAGG - Intronic
1006868372 6:37227885-37227907 ATATATAGGAAAAAGTTTTTAGG + Intronic
1008797712 6:55324204-55324226 ACATATGGTCATGAGTTTCTTGG - Intergenic
1009717558 6:67419015-67419037 ACCAATAGGCAAGAGATTGTGGG - Intergenic
1009803737 6:68575248-68575270 AGACTTAGGAAAGAGTTTGTTGG + Intergenic
1021718808 7:23486494-23486516 ACAGCTAGGTAACAGTTTGTGGG + Intergenic
1022250374 7:28601291-28601313 CCATAAAGGCAAGAGTATTTGGG + Intronic
1023180348 7:37475973-37475995 TAATAAAAGCAAGAGTTTGTTGG - Intergenic
1023195410 7:37632593-37632615 TCTTATAGGCAACAGATTGTTGG + Intergenic
1024360684 7:48464179-48464201 AAATATAGCCAGGAGTTTGAAGG + Intronic
1024488276 7:49945747-49945769 TCATGTAGGCAACAGATTGTTGG + Intronic
1024644520 7:51359931-51359953 ACATCTAGCTAAGAGTTTGTTGG - Intergenic
1027411572 7:77925472-77925494 AATTATAGGCAATAGTTTTTAGG + Intronic
1030842206 7:114369308-114369330 ACAAGTAGTCAAGAATTTGTAGG + Intronic
1033260905 7:139843193-139843215 ACATTTAGACAAGATTTTGAAGG - Intronic
1035908279 8:3537301-3537323 TCATATAAGCAAGAGTTTGCGGG - Intronic
1037632275 8:20668994-20669016 ACATACAAGCAATAGTTTGGAGG - Intergenic
1040885054 8:52253561-52253583 ACATAAGGAAAAGAGTTTGTGGG - Intronic
1042081496 8:65059260-65059282 ATATATAGTTAATAGTTTGTTGG + Intergenic
1043810286 8:84730648-84730670 AAATATAGTGAAGAGTTTTTGGG - Intronic
1045008166 8:97934007-97934029 ACAAATAGCCAAGAGATAGTTGG + Intronic
1046045834 8:108963262-108963284 TCATTTGGGCAGGAGTTTGTAGG - Intergenic
1046588327 8:116175457-116175479 ACATAATGGCAAGAGTGTATTGG - Intergenic
1046697185 8:117355365-117355387 ACATATAGAAAATAGTTTGGTGG + Intergenic
1048955350 8:139531472-139531494 ATATAAAAGCAAGAGCTTGTAGG + Intergenic
1050372512 9:4936062-4936084 ACACATAGGGTAGAGGTTGTAGG - Intergenic
1051096927 9:13477188-13477210 ACATATGGGCAAGTGTGTGCGGG - Intergenic
1052242932 9:26296652-26296674 AGATAGAAGAAAGAGTTTGTAGG - Intergenic
1056496805 9:87163936-87163958 ACATAGAGTGAAGAGATTGTTGG + Intergenic
1058232733 9:102449443-102449465 TCTTGTAGGCAAGAGTTTGTGGG - Intergenic
1059364815 9:113778438-113778460 ACATATTGGCTAGAGTGAGTGGG - Intergenic
1062167367 9:135114632-135114654 GCACAGAGGCAAGAGTTGGTAGG + Intronic
1203428688 Un_GL000195v1:67719-67741 ACTTACAGGTAAGAGGTTGTAGG + Intergenic
1203437594 Un_GL000195v1:155525-155547 GCATGCAGGCAAGAGGTTGTAGG - Intergenic
1189520767 X:41764907-41764929 AAATAAAGGCAAGATTTTGATGG - Intronic
1191713568 X:64178117-64178139 ACATAAAGCCAAGTATTTGTAGG - Intergenic
1193033134 X:76921313-76921335 ACCTCTTGGCAAGGGTTTGTGGG + Intergenic
1194198056 X:90920419-90920441 AGATATAGGCAGGAATTTCTGGG + Intergenic
1196262818 X:113604997-113605019 ATAAATAAGCAAGAGTATGTGGG - Intergenic
1196568451 X:117236341-117236363 ACATGTAGTCAACAGTTTTTAGG - Intergenic
1197488953 X:127091892-127091914 ACATATTGACAATAGTTAGTAGG + Intergenic
1200543685 Y:4492412-4492434 AGATATAGGCAGGAATTTCTGGG - Intergenic