ID: 931730798

View in Genome Browser
Species Human (GRCh38)
Location 2:65151784-65151806
Sequence TCTGAGACCCGGAAGCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931730790_931730798 19 Left 931730790 2:65151742-65151764 CCCTTTCTCCCACTTCTGTTTGT No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730789_931730798 20 Left 931730789 2:65151741-65151763 CCCCTTTCTCCCACTTCTGTTTG No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730792_931730798 11 Left 931730792 2:65151750-65151772 CCCACTTCTGTTTGTCCCAGCAC No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730791_931730798 18 Left 931730791 2:65151743-65151765 CCTTTCTCCCACTTCTGTTTGTC No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730795_931730798 -4 Left 931730795 2:65151765-65151787 CCCAGCACTGTTCTTGGACTCTG No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730793_931730798 10 Left 931730793 2:65151751-65151773 CCACTTCTGTTTGTCCCAGCACT No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data
931730796_931730798 -5 Left 931730796 2:65151766-65151788 CCAGCACTGTTCTTGGACTCTGA No data
Right 931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931730798 Original CRISPR TCTGAGACCCGGAAGCATTA AGG Intergenic
No off target data available for this crispr