ID: 931737411

View in Genome Browser
Species Human (GRCh38)
Location 2:65209053-65209075
Sequence GTGGATAATAATGCAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931737408_931737411 6 Left 931737408 2:65209024-65209046 CCGACTGCTGGAGGCAACCATGT No data
Right 931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG No data
931737404_931737411 30 Left 931737404 2:65209000-65209022 CCGGCCAATGAAACAGTTTTTTA No data
Right 931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG No data
931737405_931737411 26 Left 931737405 2:65209004-65209026 CCAATGAAACAGTTTTTTATCCG No data
Right 931737411 2:65209053-65209075 GTGGATAATAATGCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931737411 Original CRISPR GTGGATAATAATGCAGATGC TGG Intergenic
No off target data available for this crispr