ID: 931741523

View in Genome Browser
Species Human (GRCh38)
Location 2:65250000-65250022
Sequence CTCTTGGCCCAGATTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931741523 Original CRISPR CTCTTGGCCCAGATTGAGGG AGG Intronic
900557304 1:3287051-3287073 CTCATGGGCCAGATCAAGGGTGG - Intronic
901840322 1:11950157-11950179 CTCTTTGCCCAGGGTGCGGGTGG + Intronic
907612905 1:55890368-55890390 CTCTGGGCCCTACTTGAGGGAGG - Intergenic
908183274 1:61627054-61627076 CTCTTGGCCAAGATGGAGTCTGG - Intergenic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
910209953 1:84782673-84782695 CTGTTGGGCCAGGTTGGGGGCGG + Intergenic
911970255 1:104425887-104425909 GTGTTCACCCAGATTGAGGGTGG - Intergenic
913199638 1:116485285-116485307 CACTTGGCTCACATTGATGGAGG + Intergenic
915263429 1:154696538-154696560 CTCTGGGTGAAGATTGAGGGAGG - Intergenic
921450564 1:215301131-215301153 CACTTAGCCCAGACTGAGTGAGG + Intergenic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
1063289118 10:4723088-4723110 CTTTGGGCCCAGATTAATGGAGG - Intergenic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1065429751 10:25641200-25641222 TTCCTGGACCAAATTGAGGGTGG - Intergenic
1066335826 10:34477404-34477426 CACTGGGTCCAGAATGAGGGTGG + Intronic
1067218797 10:44326487-44326509 ATCTGGGGCCAGATTGAGGGAGG - Intergenic
1069618830 10:69823795-69823817 TTCTGGGCCCAGAGGGAGGGAGG - Intronic
1069940976 10:71955034-71955056 GTCTTGGCCTAGAATGGGGGTGG + Intergenic
1072208085 10:93221942-93221964 GTCTTGAGCCAGATTGAAGGTGG + Intergenic
1072740140 10:97904276-97904298 CTCAGGGCCCAGAGTGGGGGTGG - Intronic
1073050637 10:100664861-100664883 CTCTGGGCCCAGCCTGGGGGAGG + Intergenic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1077334022 11:1995355-1995377 CACCCGGCCCAGATGGAGGGCGG + Intergenic
1077354495 11:2108930-2108952 CTCTTGGCCCAGGCTGGGGATGG - Intergenic
1078112798 11:8412566-8412588 ATCCTGGACCAGATTCAGGGAGG - Intronic
1078893683 11:15579590-15579612 CTCTGTGCCCACCTTGAGGGAGG - Intergenic
1083171503 11:60926129-60926151 CTCATGGCCCTGAATGAGGAGGG + Intronic
1083838516 11:65288838-65288860 CGTTTGCCCCAGATGGAGGGAGG - Intronic
1084721604 11:70909326-70909348 CTCACGGCACAGAATGAGGGAGG + Intronic
1085661055 11:78367161-78367183 CTCTTGGTCCAAGTTGATGGGGG - Intronic
1087659540 11:100970737-100970759 CTCTTGGCACTGGCTGAGGGAGG + Intronic
1089646732 11:119885317-119885339 CTCCAGGCCCACAGTGAGGGAGG + Intergenic
1090519135 11:127459967-127459989 TTTTTGGCCTAGTTTGAGGGGGG - Intergenic
1090636009 11:128690991-128691013 CTCTGGGCCCAGCTTGGGGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1202817005 11_KI270721v1_random:50537-50559 CACCCGGCCCAGATGGAGGGCGG + Intergenic
1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG + Intronic
1094487081 12:30933823-30933845 CTCTTGGTTCAGATTGAGTTGGG + Intronic
1095908586 12:47403141-47403163 CACTGGGCCCAGACTGAGGCTGG - Intergenic
1096227334 12:49874585-49874607 CTCTGGGGCCACATTCAGGGAGG - Intronic
1098545668 12:71708161-71708183 CTCTGGTCCAAGCTTGAGGGTGG + Intergenic
1109706425 13:66099194-66099216 CTCTAGGCTCATATTGAAGGAGG + Intergenic
1110174141 13:72536238-72536260 CTCTGTGTCCAGATTAAGGGAGG - Intergenic
1110477136 13:75929321-75929343 ATGTTGGCCCACATTGTGGGTGG - Intergenic
1119195089 14:72711905-72711927 CTCCTTGCCCAGTTTGGGGGTGG + Intronic
1124627049 15:31313999-31314021 CTGTTGCCCCAGATTGGGGTTGG - Intergenic
1125408696 15:39382221-39382243 CACTGGGCCCTGTTTGAGGGTGG + Intergenic
1126377457 15:48010559-48010581 CTCTTGGCCTACATTGGTGGGGG + Intergenic
1128246128 15:66134066-66134088 CTCTTGACCCTGATTAATGGTGG - Intronic
1129154575 15:73709841-73709863 CTCTTTGCCCAGAGTTAGGCAGG + Intronic
1132061324 15:98694518-98694540 CTCCTGGGCCAGACTCAGGGTGG + Intronic
1134454097 16:14381352-14381374 GTGTTGTCCCAGACTGAGGGAGG + Intergenic
1137850126 16:51733429-51733451 ATCTTGGGCCAATTTGAGGGAGG + Intergenic
1138773222 16:59689074-59689096 CTCTTGTCTCAGAGGGAGGGAGG + Intergenic
1139924440 16:70478465-70478487 CTCTGGCCCCAGCATGAGGGAGG + Intronic
1141851454 16:86649123-86649145 CTGTTGGCCCAGATTAAGCCTGG + Intergenic
1144826687 17:18109156-18109178 CTCTGGGCCCAGGGTGAGGTAGG + Intronic
1144851838 17:18247726-18247748 CTCCTGACCCAGCTTGAGGGCGG + Exonic
1147191420 17:38740230-38740252 CTCTGTGCCCAGATTGGGGCGGG - Intronic
1147953666 17:44120877-44120899 CTGTTGGCCTAGCTTGGGGGAGG - Intronic
1147997111 17:44366259-44366281 CTGTTGGCCCAGGGTGAGGTAGG + Intergenic
1148028539 17:44604811-44604833 CTCATGGACGAGAATGAGGGGGG - Intergenic
1148747144 17:49924737-49924759 CTCCTCTCACAGATTGAGGGAGG + Intergenic
1151750186 17:76032746-76032768 CTCTAGGCCCAGCTGGAGGAGGG - Intergenic
1154342841 18:13518652-13518674 CTCTTGGCCTAGGTTGAAGGTGG + Intronic
1156036366 18:32771139-32771161 CAGTTGGCCCAGTTTGGGGGAGG + Intronic
1156871959 18:41955458-41955480 CTCAAGGCCCAGATTGGGGGCGG + Intronic
1158688757 18:59641431-59641453 CTCTGGGGCCTGCTTGAGGGTGG + Intronic
1158980493 18:62755988-62756010 CACTTGGCACAAATTGAAGGGGG - Intronic
1164222044 19:23203796-23203818 CTCCTGACCCAGAGTGAGGCTGG + Intergenic
1165373214 19:35423305-35423327 CTCTTGGCCTAGAAACAGGGAGG - Intergenic
1167029351 19:46947039-46947061 CTCTTGTCCCTGGTTGAGTGGGG + Intronic
1168132954 19:54332479-54332501 CTCTGGGCTCAGAGGGAGGGTGG - Intergenic
1168451407 19:56469359-56469381 CTCTGGGGTCAGACTGAGGGTGG + Intronic
1168509912 19:56966178-56966200 CTCTTGGCTCAGATAGAGGTGGG + Intergenic
926275175 2:11398064-11398086 CTCTTGGCTGAGGTTCAGGGTGG + Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
932218080 2:69979564-69979586 CTTTGTGCCCAGTTTGAGGGGGG - Intergenic
932566736 2:72915769-72915791 CACTTTTCCCAGACTGAGGGTGG + Intergenic
933657925 2:84905018-84905040 CTCTTTGCTCAGGTTGGGGGCGG - Intronic
933747490 2:85581761-85581783 CTCTTGGCACACATTTATGGAGG - Exonic
934720170 2:96568631-96568653 CTGCTGGCTCAGGTTGAGGGTGG + Intergenic
939936178 2:148296648-148296670 CTCGTGGTCCAGATGGAGGCAGG + Intronic
942521965 2:176813957-176813979 CTATTGGCCTAGATTTAGTGGGG - Intergenic
942525170 2:176845417-176845439 ATCTTGGCCCAGGTTCAGGGAGG + Intergenic
943484790 2:188465554-188465576 CTCTGGGCCCAGAGTCAGTGTGG - Intronic
944641581 2:201731902-201731924 CTTTTGTCCCAGAATGAGGATGG + Intronic
947524077 2:230868059-230868081 GTCCAGGCCCAGAGTGAGGGCGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170254546 20:14325953-14325975 CTCTTGCTCTCGATTGAGGGTGG + Exonic
1170816783 20:19720820-19720842 CTCTCGTCTCAGATTGTGGGAGG - Intronic
1170950259 20:20930393-20930415 CTCTTGGGTCAGGCTGAGGGTGG + Intergenic
1171502794 20:25606840-25606862 CTCTTGGACCACATGGAGAGCGG + Intergenic
1172313339 20:33934504-33934526 CTATCCACCCAGATTGAGGGTGG - Intergenic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1172650514 20:36498740-36498762 CTCATGCCCTAGATTGAGTGTGG + Intronic
1173395128 20:42672199-42672221 GTGTTCACCCAGATTGAGGGTGG - Intronic
1175628630 20:60512008-60512030 CTCTGGTTCCAGATTGGGGGTGG - Intergenic
1176850569 21:13909153-13909175 CTCTGGGCCCACATGCAGGGAGG - Intergenic
1179136365 21:38683502-38683524 CTCTTGGTGCAGATTGTGGATGG + Intergenic
1182118612 22:27772933-27772955 CACTAGGCCCAGTTTGAGGCTGG + Intronic
1182583262 22:31327967-31327989 CTCTTGGCCCAGCTTGTCTGGGG - Intronic
1182884583 22:33762563-33762585 CTCTTCTTCCATATTGAGGGTGG - Intronic
1183067984 22:35376897-35376919 CTCTTGGCCAAGCTGGATGGTGG - Intergenic
1183611133 22:38907149-38907171 CTCTTGGCCAAGATGGGGGAAGG - Intergenic
1185189694 22:49427469-49427491 CTCGTGGCCCAGCTGGAGTGAGG - Intronic
950831471 3:15879512-15879534 ATATTGGCCCAGATCAAGGGTGG + Intergenic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
951072951 3:18353327-18353349 ATCTAGCCCCAGATTGATGGAGG - Intronic
956545286 3:70394436-70394458 CGCTTGGCCCAAACTGTGGGAGG - Intergenic
960742000 3:120844548-120844570 CAATTGGTCCAGATTGAGGCAGG - Intergenic
961785425 3:129344216-129344238 CTCTTTGCCCAGGTTGGGCGGGG + Intergenic
967151175 3:186652364-186652386 CTCTTGGCCCAGCTTTGGAGGGG - Exonic
970238060 4:13978924-13978946 CTCTTGGGCCTGCTTGAGGGTGG - Intergenic
971451958 4:26808957-26808979 CTCTTGGCTCAAACAGAGGGTGG + Intergenic
972724283 4:41732656-41732678 GTCTTGGCCCACAAAGAGGGAGG + Intergenic
976687846 4:87835742-87835764 CTCTAGGCCTTGATTGAGTGAGG - Intronic
977026408 4:91823706-91823728 GTGTTCACCCAGATTGAGGGTGG + Intergenic
977558034 4:98504549-98504571 CTCTTGCCCCATATTAAGAGTGG + Intronic
977997124 4:103508066-103508088 TTCTTGTCACAGATTGAGTGGGG - Intergenic
982089441 4:151867632-151867654 CACTTGGCCTAGATTGGGGAAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
983991549 4:174126106-174126128 CTCCTGGCCTAGATTCAGGTAGG + Intergenic
986055881 5:4136173-4136195 TGCTGGGCCCAGGTTGAGGGTGG + Intergenic
988900842 5:35730435-35730457 CCCTGGGCCCAGTTTCAGGGAGG - Intronic
990442063 5:55856491-55856513 CTTATGGCCCAGATTTGGGGAGG + Intronic
991125683 5:63067205-63067227 CTCTTAGCCAAGTTTGGGGGAGG + Intergenic
991559360 5:67933127-67933149 ATCTTGGCCCAGATTGACTGAGG - Intergenic
1001651544 5:173319505-173319527 CTGGTGGCCCAGACTTAGGGAGG - Intronic
1002462506 5:179381740-179381762 CTCTTGGCCCTTGGTGAGGGAGG - Intergenic
1004620163 6:17324660-17324682 GTCTTGGCCTAGAATGGGGGTGG + Intergenic
1004731903 6:18366775-18366797 GTGTTGGCCCAGATCGAGGGTGG - Intergenic
1007410589 6:41659034-41659056 CTCTTGGCCCGGATTAATGGAGG + Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1013961581 6:115907424-115907446 CTCTTGGCACAGCATTAGGGTGG - Intergenic
1019088244 6:169501824-169501846 CTCCTCGACCAGCTTGAGGGAGG - Intronic
1019136412 6:169911468-169911490 CTCTGGGGCCAGGCTGAGGGGGG - Intergenic
1020574772 7:9912946-9912968 CTCTTGGCCTAGTTTGATGGTGG - Intergenic
1022358112 7:29634968-29634990 CTCTTTCCCCAGATAGAGGCTGG + Intergenic
1032018564 7:128394296-128394318 ATGTCGGCCCAGATTGAGGGTGG - Exonic
1033097222 7:138442182-138442204 ATGTTGGCCCAGATCAAGGGTGG + Intergenic
1035459994 7:159032630-159032652 CTCTTGGCCCCTATCCAGGGAGG + Intronic
1042754274 8:72193211-72193233 CTCTTGACCAAGATTTAGAGGGG - Intergenic
1042765817 8:72321110-72321132 CTCTTGACCAAGATTTAGAGGGG - Intergenic
1043477552 8:80619868-80619890 CTCATGGCTCATATTTAGGGAGG + Intergenic
1045921933 8:107540479-107540501 CTCTTGGTGGAGAGTGAGGGTGG + Intergenic
1047124443 8:121944822-121944844 CTATTGAACCAGATTCAGGGAGG + Intergenic
1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG + Intronic
1047714454 8:127582771-127582793 CTCTTGTCCCAGCTTTTGGGAGG + Intergenic
1047793493 8:128230654-128230676 CTCTTTGCCCTGATTCAAGGTGG + Intergenic
1048207855 8:132430020-132430042 TTCTTGGCCCAGGGTGTGGGAGG - Intronic
1051745804 9:20293566-20293588 CCCTTTGACCAGAGTGAGGGTGG - Intergenic
1052941217 9:34133197-34133219 ATGTCGGCCCAGATCGAGGGTGG - Intergenic
1055589987 9:77802268-77802290 CTGTGAGCCCAGAGTGAGGGGGG - Intronic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1062501171 9:136852675-136852697 CTCTTGTCCCAGACTGGGAGGGG - Intronic
1189361846 X:40359223-40359245 GTGTCGGCCCAGATCGAGGGTGG - Intergenic
1189893799 X:45632755-45632777 CTCCAGGCTGAGATTGAGGGCGG - Intergenic
1195828735 X:109032558-109032580 CTCTTGGCCAAGAGTGACTGTGG - Intergenic
1196085474 X:111679152-111679174 CTCTCGGACCAAACTGAGGGTGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1199778139 X:151033666-151033688 CTCAGGGCCCAGGCTGAGGGAGG + Intergenic