ID: 931746354

View in Genome Browser
Species Human (GRCh38)
Location 2:65294854-65294876
Sequence AAGGGCAAACATTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931746350_931746354 9 Left 931746350 2:65294822-65294844 CCAGGGCTGAGCGTTCAGGCAGA No data
Right 931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG No data
931746347_931746354 22 Left 931746347 2:65294809-65294831 CCATGCGGAGATCCCAGGGCTGA No data
Right 931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG No data
931746349_931746354 10 Left 931746349 2:65294821-65294843 CCCAGGGCTGAGCGTTCAGGCAG No data
Right 931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931746354 Original CRISPR AAGGGCAAACATTCTGAGGC AGG Intergenic
No off target data available for this crispr