ID: 931747880

View in Genome Browser
Species Human (GRCh38)
Location 2:65306770-65306792
Sequence TTTATTGGGGAGTAGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931747880_931747890 28 Left 931747880 2:65306770-65306792 CCCCCTCTCTACTCCCCAATAAA No data
Right 931747890 2:65306821-65306843 AACCTCATAATGTGACTATTTGG No data
931747880_931747885 -10 Left 931747880 2:65306770-65306792 CCCCCTCTCTACTCCCCAATAAA No data
Right 931747885 2:65306783-65306805 CCCCAATAAAATTCAAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931747880 Original CRISPR TTTATTGGGGAGTAGAGAGG GGG (reversed) Intergenic
No off target data available for this crispr