ID: 931748552

View in Genome Browser
Species Human (GRCh38)
Location 2:65311535-65311557
Sequence CTTCCTTGGGGTCTTTCTCT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 285}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931748552_931748558 -9 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 112
931748552_931748560 -7 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748560 2:65311551-65311573 AAGGAAGTGCCTCCGGGTCGGGG 0: 1
1: 0
2: 1
3: 3
4: 70
931748552_931748563 1 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748563 2:65311559-65311581 GCCTCCGGGTCGGGGGAAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 287
931748552_931748559 -8 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748559 2:65311550-65311572 CAAGGAAGTGCCTCCGGGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 112
931748552_931748566 18 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748566 2:65311576-65311598 AGGTGGTCTCTCGACAGCACTGG 0: 1
1: 0
2: 0
3: 9
4: 79
931748552_931748568 25 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748568 2:65311583-65311605 CTCTCGACAGCACTGGAGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 179
931748552_931748561 -6 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748561 2:65311552-65311574 AGGAAGTGCCTCCGGGTCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 93
931748552_931748567 21 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748567 2:65311579-65311601 TGGTCTCTCGACAGCACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 90
931748552_931748562 -2 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748562 2:65311556-65311578 AGTGCCTCCGGGTCGGGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748552 Original CRISPR CTTCCTTGGGGTCTTTCTCT AGG (reversed) Exonic