ID: 931748558

View in Genome Browser
Species Human (GRCh38)
Location 2:65311549-65311571
Sequence CCAAGGAAGTGCCTCCGGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931748552_931748558 -9 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 112
931748551_931748558 -8 Left 931748551 2:65311534-65311556 CCCTAGAGAAAGACCCCAAGGAA 0: 1
1: 0
2: 2
3: 22
4: 200
Right 931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748558 Original CRISPR CCAAGGAAGTGCCTCCGGGT CGG Exonic