ID: 931748558

View in Genome Browser
Species Human (GRCh38)
Location 2:65311549-65311571
Sequence CCAAGGAAGTGCCTCCGGGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931748551_931748558 -8 Left 931748551 2:65311534-65311556 CCCTAGAGAAAGACCCCAAGGAA 0: 1
1: 0
2: 2
3: 22
4: 200
Right 931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 112
931748552_931748558 -9 Left 931748552 2:65311535-65311557 CCTAGAGAAAGACCCCAAGGAAG 0: 1
1: 0
2: 2
3: 20
4: 285
Right 931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG 0: 1
1: 0
2: 0
3: 2
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748558 Original CRISPR CCAAGGAAGTGCCTCCGGGT CGG Exonic
903545395 1:24120747-24120769 CCAAGGATGTGACACTGGGTAGG + Exonic
904285147 1:29449203-29449225 CCAGGGCAGTGCCGCAGGGTGGG + Intergenic
904420185 1:30386178-30386200 CCAGGGCAGTGCCGCAGGGTGGG - Intergenic
905478501 1:38245435-38245457 CCAAGGAAGCGCCTTGGGATGGG - Intergenic
905824894 1:41020163-41020185 CCAAGGGAGAGCCTCTGAGTGGG - Intronic
907295962 1:53454519-53454541 CCTAGGAAGTTTCTCCAGGTTGG + Intergenic
912857761 1:113186576-113186598 GCAAGGAAGGGCATGCGGGTGGG + Intergenic
914753679 1:150551479-150551501 CCAAGGAAGGGGCTTCTGGTGGG + Intronic
915051888 1:153084028-153084050 GCAAGGAAGTGCATCCAGGCTGG - Intergenic
924946597 1:248850816-248850838 CCAAGGAGGGGCCACAGGGTGGG - Intronic
1072436083 10:95415738-95415760 CCAAGGGAGTGCCTTCGGCAGGG + Intronic
1072459711 10:95607782-95607804 CTAAGGAAGTGCCTTTTGGTTGG + Intronic
1072567434 10:96628684-96628706 GCAAGGAAGAGCCTGAGGGTTGG - Intronic
1073328441 10:102656156-102656178 CCCAGGATGTGCCCCCGGGAGGG - Intronic
1075342648 10:121659905-121659927 CATAGGAACTGCCTCCAGGTGGG - Intergenic
1075416710 10:122269614-122269636 CCCAGCAACTGCCACCGGGTTGG - Intergenic
1076503583 10:130956504-130956526 GCAAGGAAGGGCCTCAGGGAGGG + Intergenic
1076664024 10:132075885-132075907 CTAAGGAAGTTCCTCAGGGGAGG - Intergenic
1076786344 10:132751824-132751846 CCCAGGAAGTGCCTTCGTGGAGG + Intronic
1077194556 11:1272653-1272675 CCAAGGAACTTCTTCCGGATAGG - Intergenic
1077370220 11:2178217-2178239 GGAAGGAAGGGCATCCGGGTGGG + Intergenic
1077417716 11:2432623-2432645 CCAAGGATGTGCCTGGGGGGAGG - Intergenic
1079617471 11:22513058-22513080 CCAAACAAGTGGCTCAGGGTGGG - Intergenic
1083800907 11:65045781-65045803 CCTGGGAGGTGCCTCCAGGTGGG - Intronic
1084501871 11:69539909-69539931 ACAGGGAAGTGCCTCCGTGGAGG - Intergenic
1085458597 11:76679627-76679649 CCAGGGAAGGGACTCCGGGAAGG + Intergenic
1089018008 11:115182793-115182815 CCATGGAAGTGGCTGCGGGATGG - Intronic
1091821199 12:3476449-3476471 CCAGGGAAGTGCCTGCGAGCTGG + Intronic
1094664601 12:32506615-32506637 GCAAGGAGGTGCCTGTGGGTTGG - Intronic
1095626586 12:44321594-44321616 TCAAGGAAGCACCTCTGGGTGGG - Intronic
1097088630 12:56488021-56488043 CCAAGGAGGGGGCTCCGGCTCGG + Exonic
1103554036 12:121755194-121755216 ACCAAGAAGGGCCTCCGGGTGGG - Intronic
1104940622 12:132392911-132392933 CCCAGAAAGTGCCTCAGCGTCGG + Intergenic
1108737633 13:53301246-53301268 CCAAGGAAATGCCACCCTGTGGG - Intergenic
1113232067 13:108222990-108223012 TTAAGGAAGTGCCTCCTGTTGGG - Intronic
1116997357 14:51337594-51337616 CCCAGGCAGGGCCTCAGGGTGGG + Intergenic
1119182782 14:72615611-72615633 CCAGGGAAGAGCCTGTGGGTGGG - Intergenic
1121572798 14:94960180-94960202 CCAAGGAAGAGACTGAGGGTCGG - Intergenic
1122461422 14:101898687-101898709 GCAATGAAGTGTCCCCGGGTGGG - Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1130957542 15:88638369-88638391 CCAAGGAAGTGTGGCCGGGCTGG + Intronic
1132030280 15:98433401-98433423 CCACTGAAGTGCTTCCGGGAGGG - Intergenic
1134477085 16:14583773-14583795 CCAAGGAAGTAGCACCTGGTAGG + Intronic
1137398947 16:48137499-48137521 CAAAGGAAGTGCCCCAGGTTGGG - Intronic
1142442020 16:90104789-90104811 CCCACGAAGTGCATCTGGGTTGG + Intergenic
1142850162 17:2700922-2700944 CCAGGGCAGTGTCTCAGGGTGGG - Intronic
1151289925 17:73142378-73142400 CCAAGGAAGTGGGTTCAGGTTGG + Intergenic
1158609190 18:58923457-58923479 CCAAGGAAGAGACTCCAGGTTGG - Intronic
1160845410 19:1164029-1164051 CCAAGGACCTCCCTCCAGGTGGG + Intronic
1162009332 19:7802294-7802316 CCAAGGAGGTGACTCAGGATGGG - Intergenic
1162124686 19:8493158-8493180 CCAAGGAATTGGCTTCAGGTGGG + Intronic
1162312527 19:9915351-9915373 CCAAGAATGAGCCTCCGGGTTGG + Intronic
1163425856 19:17240685-17240707 CTCAAGAAGTGCTTCCGGGTGGG - Exonic
1165431364 19:35775400-35775422 CCAATGAGAAGCCTCCGGGTGGG + Intronic
1167044675 19:47042672-47042694 CCTTGTAAGTGCCTCAGGGTGGG + Intronic
927718097 2:25365414-25365436 GCCAGGAAGTGCCTCCAGGCAGG + Intergenic
931748558 2:65311549-65311571 CCAAGGAAGTGCCTCCGGGTCGG + Exonic
932217522 2:69976420-69976442 CTATGGAAGTGACTCCTGGTAGG - Intergenic
938574741 2:132593415-132593437 CCAATGAAGTGACTCATGGTGGG - Intronic
943527597 2:189037324-189037346 CCAAGGCAGTGCCTGGTGGTAGG + Intronic
946471723 2:219966862-219966884 CCAGGGAATTGACTTCGGGTGGG - Intergenic
948944274 2:241211543-241211565 AGGAGGAAGTGCCTCCTGGTGGG + Intronic
1171088556 20:22262299-22262321 CCAAGGCAGCGACTCAGGGTGGG + Intergenic
1172409289 20:34709897-34709919 CCGAGGAGGCACCTCCGGGTTGG + Intronic
1173617527 20:44412836-44412858 GCAGGGAAATGCCTACGGGTAGG + Intronic
1179951305 21:44710243-44710265 CCAAGGCAGTCCCTGCGGGCAGG + Intronic
1180698568 22:17769594-17769616 GCAAGGAAGTGCCTGCTGGAAGG + Intronic
1181054387 22:20253196-20253218 GCGAGGAAGTGGCTCCAGGTGGG - Intronic
1181675068 22:24445948-24445970 CCAAGGAAGTGTTTCCGTTTGGG + Intergenic
1183200010 22:36379635-36379657 CCAAGGAAGTGACTCGAGGGTGG + Intronic
1184289766 22:43492459-43492481 CTAAGGAATGGCCTCTGGGTGGG - Intronic
1185297440 22:50061296-50061318 CCGAGGAAGGGCCCCCGGCTCGG - Exonic
950437116 3:12986707-12986729 CCTAGTATGTGCCTCTGGGTGGG - Intronic
953974338 3:47371109-47371131 GGAAGGAAGGGCCTCCGGGGCGG - Intergenic
954406682 3:50349096-50349118 GCAAGCAGGTGCCTCTGGGTAGG + Intronic
955383246 3:58458342-58458364 CCAAGGTATTGCCTCCTGGCAGG - Intergenic
958719356 3:97824938-97824960 ACCAGGAAGTGCTTCCTGGTAGG + Intronic
961642090 3:128371213-128371235 CCAAGGATGAGCCTCAGGGCTGG - Intronic
963253242 3:143120646-143120668 CCATGGCAGCGGCTCCGGGTAGG - Exonic
968066934 3:195764003-195764025 CCCAGGAAGAGCCTCTGGGGAGG - Intronic
968866203 4:3213648-3213670 CCAAGGAAGAGCCTCTGGCCTGG + Intronic
973827348 4:54721649-54721671 CCAGGGAGGTGCCTCCAGGGAGG + Intronic
980968492 4:139546774-139546796 CCAAAGCAGTGCCTACAGGTAGG + Intronic
985632056 5:1018880-1018902 CCAAGGATGTTCCTCCCTGTGGG - Intronic
986542746 5:8864133-8864155 CCATGGTAGTGTCTACGGGTGGG - Intergenic
990478390 5:56184261-56184283 CCAAGAAAGAGCCTCCTGTTGGG - Intronic
992093853 5:73342379-73342401 CCAAGGAATTGCCACCTGCTTGG + Intergenic
992669463 5:79044299-79044321 CCAATGGAGTTCCTCCAGGTGGG - Exonic
994692782 5:103038239-103038261 GGAAGGAAGTGCCTCTGGCTAGG - Intergenic
995184170 5:109254268-109254290 CCCACTCAGTGCCTCCGGGTTGG - Intergenic
995395851 5:111686174-111686196 CCAGGGAAGTGTCTACAGGTTGG + Intronic
996463968 5:123778738-123778760 CCATGGCAGTGCCTAGGGGTGGG + Intergenic
997529394 5:134572663-134572685 CCAAGGAAGTGTCTCAAGGGAGG + Intronic
997994485 5:138575047-138575069 CCAAGGTTTTGCCTCCGGCTTGG - Intronic
1003517872 6:6832769-6832791 CCAAGGTTGTGCCTCAGGTTAGG - Intergenic
1003877523 6:10451573-10451595 CCAAGGAAGGGCCACCGGAGGGG + Intergenic
1006982107 6:38155004-38155026 CCTAGGAAGGGCCTCCAGGATGG + Intergenic
1008021521 6:46583661-46583683 ACAAGGAAGTGCCTCGCAGTGGG + Intronic
1010941118 6:81918742-81918764 CCAAGGAAGTGGCCCAGGCTTGG + Intergenic
1014427074 6:121321292-121321314 CCAAGTAAGTCCCTCCCGGAGGG - Intronic
1018910597 6:168099048-168099070 TCAAGGCAGTGACTCTGGGTGGG + Intergenic
1020356399 7:7280366-7280388 CAAAGGATGTGACTCAGGGTAGG + Intergenic
1029652766 7:101905098-101905120 CCAAGGCTGTGTCTCTGGGTGGG + Intronic
1031640232 7:124154114-124154136 CCAATGAAGAGCCTCTGGGAGGG + Intergenic
1032150805 7:129427863-129427885 CCAAGGAAGCCCCTCCAGATTGG + Exonic
1047572216 8:126111355-126111377 CCAAGGAAGTGGGTGTGGGTTGG - Intergenic
1048761433 8:137799712-137799734 CTGAGGAAGTTCCTCTGGGTGGG + Intergenic
1049205392 8:141361231-141361253 CCAAGGAAGTACCTGTGTGTGGG - Intronic
1049341374 8:142114392-142114414 CCAAGGCAGTGCCCCAGGGAGGG + Intergenic
1055010132 9:71556158-71556180 CCATGGAAGTGCCTGTGTGTAGG - Intergenic
1057449419 9:95143444-95143466 CTAATGAAGTGACTCCTGGTGGG - Intronic
1061444918 9:130632275-130632297 CCAAGTAAGTGACTCGGGGCGGG + Exonic
1186276696 X:7947052-7947074 ACAAGGAAGGGGCTCCAGGTCGG + Intergenic
1189323247 X:40098381-40098403 CCCAGGACGTGCGCCCGGGTCGG - Intronic
1196458260 X:115904955-115904977 AGAAGGAAGTTCCCCCGGGTGGG - Intergenic