ID: 931748560 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:65311551-65311573 |
Sequence | AAGGAAGTGCCTCCGGGTCG GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 75 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 3, 4: 70} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931748551_931748560 | -6 | Left | 931748551 | 2:65311534-65311556 | CCCTAGAGAAAGACCCCAAGGAA | 0: 1 1: 0 2: 2 3: 22 4: 200 |
||
Right | 931748560 | 2:65311551-65311573 | AAGGAAGTGCCTCCGGGTCGGGG | 0: 1 1: 0 2: 1 3: 3 4: 70 |
||||
931748552_931748560 | -7 | Left | 931748552 | 2:65311535-65311557 | CCTAGAGAAAGACCCCAAGGAAG | 0: 1 1: 0 2: 2 3: 20 4: 285 |
||
Right | 931748560 | 2:65311551-65311573 | AAGGAAGTGCCTCCGGGTCGGGG | 0: 1 1: 0 2: 1 3: 3 4: 70 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931748560 | Original CRISPR | AAGGAAGTGCCTCCGGGTCG GGG | Exonic | ||