ID: 931748561 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:65311552-65311574 |
| Sequence | AGGAAGTGCCTCCGGGTCGG GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 104 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 8, 4: 93} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931748551_931748561 | -5 | Left | 931748551 | 2:65311534-65311556 | CCCTAGAGAAAGACCCCAAGGAA | 0: 1 1: 0 2: 2 3: 22 4: 200 |
||
| Right | 931748561 | 2:65311552-65311574 | AGGAAGTGCCTCCGGGTCGGGGG | 0: 1 1: 0 2: 2 3: 8 4: 93 |
||||
| 931748552_931748561 | -6 | Left | 931748552 | 2:65311535-65311557 | CCTAGAGAAAGACCCCAAGGAAG | 0: 1 1: 0 2: 2 3: 20 4: 285 |
||
| Right | 931748561 | 2:65311552-65311574 | AGGAAGTGCCTCCGGGTCGGGGG | 0: 1 1: 0 2: 2 3: 8 4: 93 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931748561 | Original CRISPR | AGGAAGTGCCTCCGGGTCGG GGG | Exonic | ||