ID: 931748615

View in Genome Browser
Species Human (GRCh38)
Location 2:65311967-65311989
Sequence CCGCTACCACAGAAAGATCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931748613_931748615 -7 Left 931748613 2:65311951-65311973 CCATGTCTTCTGCTGGCCGCTAC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 931748615 2:65311967-65311989 CCGCTACCACAGAAAGATCGTGG 0: 1
1: 0
2: 0
3: 2
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748615 Original CRISPR CCGCTACCACAGAAAGATCG TGG Exonic
904378464 1:30096005-30096027 CCGTTCCCAAAGAAAGATGGGGG - Intergenic
921393222 1:214638668-214638690 CCGCCACCACACCAAGATTGGGG - Intronic
922648406 1:227316131-227316153 CCACTACTACAGACAGATCTGGG + Intronic
1080806971 11:35662783-35662805 CCGCTACCAGGGAGAGATCGCGG - Exonic
1082662595 11:55931043-55931065 CTGATACCACAGAAATATCAAGG - Intergenic
1085599604 11:77843384-77843406 CCTCAACAACAGAAAGATGGGGG + Intronic
1087180389 11:95136084-95136106 CCGCAAACACAGAAAGCTGGTGG - Intergenic
1089060174 11:115619973-115619995 GCCCTACCAGAGAAAGATGGGGG - Intergenic
1091488285 12:910710-910732 CCACTACCACAGAAAGAGGCTGG + Exonic
1099553710 12:84081587-84081609 CTTCTACCAGAGAAATATCGTGG + Intergenic
1102108356 12:110345021-110345043 CCGAAACCACAGAAAGGTCAAGG - Intronic
1103981232 12:124738268-124738290 CAGCTTCCACAGAAAGTTCCAGG + Intergenic
1105587526 13:21758813-21758835 CTGCTACCAAAGGAAGATGGGGG - Intergenic
1107064438 13:36197377-36197399 CAGCTACCAGAGACAGATCCGGG - Intronic
1128258172 15:66213324-66213346 CCGTTCACACAGAAAGATGGTGG + Intronic
1143575704 17:7792030-7792052 CAGCTACCTCCGAGAGATCGAGG + Exonic
1146447536 17:32944310-32944332 CCTCTTCCACAGAAAGCTCTTGG - Exonic
927922812 2:26986554-26986576 CAGCTGCAACAGAAAGATGGGGG + Intronic
931748615 2:65311967-65311989 CCGCTACCACAGAAAGATCGTGG + Exonic
932815496 2:74857928-74857950 CCTCTCCCACAGAAGGCTCGAGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
1176929270 21:14788891-14788913 CGGCTACCACAGAAGGAAAGTGG - Intergenic
1180137677 21:45871717-45871739 CCGCGGCACCAGAAAGATCGTGG - Intronic
962201405 3:133403741-133403763 CAGCTAGCACAGAAAGCTCCTGG + Intronic
986335119 5:6748962-6748984 CCACTACCACAGAATGATCTGGG - Intronic
997103656 5:130994959-130994981 CCTCTACCACAGAAAGGAAGTGG + Intergenic
1001713664 5:173797599-173797621 CAGCTACCTCAGCAAGAACGTGG - Intergenic
1011247061 6:85330700-85330722 AGGCTACAACAAAAAGATCGAGG + Intergenic
1013167748 6:107608979-107609001 CCACTACCAAAGAAAAATCTAGG + Intronic
1015486844 6:133781356-133781378 CCGATACCACAGAAATATAAAGG - Intergenic
1034620871 7:152456180-152456202 CCACTGCCACAGAAACATCCCGG + Intergenic
1037256369 8:16959989-16960011 CCGATACCACTGAAAGAACAGGG + Intergenic
1037521207 8:19682040-19682062 CCTGTACCACAGAAAGATTTTGG + Intronic
1041981291 8:63864303-63864325 CCCCTAACAAAGCAAGATCGTGG - Intergenic
1045065776 8:98442655-98442677 CAGCTACCACACAGAGATAGTGG - Intronic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1061222126 9:129258454-129258476 CCGATACGACAGCAAGCTCGGGG - Intergenic
1200814517 Y:7517747-7517769 CCAGTACCATAGAAAGATGGAGG + Intergenic