ID: 931748705

View in Genome Browser
Species Human (GRCh38)
Location 2:65312654-65312676
Sequence CTACTTTAGGGGTAATGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748705 Original CRISPR CTACTTTAGGGGTAATGGGG AGG Exonic
902262258 1:15235481-15235503 CTACTTGAGGGGAAAGGAGGTGG + Intergenic
906723312 1:48024968-48024990 TTGCTTTAGGGGGGATGGGGTGG - Intergenic
908201190 1:61797441-61797463 CTACTTGAGGGATAGAGGGGTGG - Intronic
908589922 1:65619560-65619582 CCACTTTGGGGGTAAGGGAGAGG + Intronic
909395723 1:75168960-75168982 ATATTTTAGGGGGAAAGGGGTGG - Intergenic
912049992 1:105517447-105517469 CTATTTTAGGAGAAATGGTGAGG - Intergenic
915145395 1:153793614-153793636 CTAATTTGGGGGTCCTGGGGAGG - Intergenic
916892867 1:169130098-169130120 CAAATTTAGGGTTACTGGGGTGG + Intronic
919452314 1:197787003-197787025 CTAATTCAGGGGTACTGTGGGGG + Intergenic
920286752 1:204885242-204885264 TCACTTTAGGGGTGATGGGTGGG - Intronic
922073790 1:222222008-222222030 ATACTTTAATGGTAATTGGGAGG - Intergenic
1064839400 10:19573574-19573596 CTTTTTTAGGGGGAAAGGGGTGG - Intronic
1071200759 10:83219148-83219170 CAACTTTGGGGGTTTTGGGGAGG + Intergenic
1071376947 10:85015755-85015777 CTACTGTAGGGTTAAAGGGAGGG - Intergenic
1071578629 10:86749937-86749959 CTACTCCAGTGGCAATGGGGAGG - Intergenic
1081543748 11:44054963-44054985 CTAGCTTGGGGGTAATGGGAAGG - Intronic
1089654499 11:119936820-119936842 CTATTCTATGGGTAATAGGGGGG - Intergenic
1091619357 12:2074719-2074741 ATACTTTAGGGTTTATAGGGTGG + Intronic
1091669001 12:2439031-2439053 CTTCTTTGGGGGCAATGGAGTGG - Intronic
1093258487 12:16902986-16903008 CTACTCTAGGGGTGGAGGGGTGG + Intergenic
1096047338 12:48574394-48574416 ATACTTTATGGGGAATGCGGTGG - Intergenic
1103351433 12:120286437-120286459 GTACTTTAGTGGGGATGGGGTGG - Intergenic
1113185462 13:107681896-107681918 CTTGTTTAGGGGTAGTGGAGAGG - Intronic
1116564113 14:46423169-46423191 TGACTTTAGGGATGATGGGGTGG + Intergenic
1117354118 14:54906986-54907008 CTTCTTCTGGGGTAATGTGGAGG - Intergenic
1119482314 14:74965713-74965735 CTACTTTGGGTGTAATGAGGTGG + Intergenic
1120731191 14:88003100-88003122 CTACTCATGGGGTAATGGGGAGG - Intergenic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126319813 15:47409884-47409906 CTATTTTCGGGGTTGTGGGGGGG + Intronic
1126652886 15:50943777-50943799 CTACTTTATGATTAATGGGCTGG + Intronic
1127112279 15:55687597-55687619 GTACTTTAGGCCTAATGGGCTGG + Intronic
1128596530 15:68956779-68956801 CTACTGTAGTGGTGAGGGGGAGG + Intronic
1133536787 16:6710075-6710097 CTATTTGTGGGGTATTGGGGAGG + Intronic
1134516308 16:14889902-14889924 CTACTTTACAGGAAATAGGGAGG + Intronic
1134703982 16:16288554-16288576 CTACTTTACAGGAAATAGGGAGG + Intronic
1134963561 16:18423560-18423582 CTACTTTACAGGAAATAGGGAGG - Intronic
1134967856 16:18506159-18506181 CTACTTTACAGGAAATAGGGAGG - Intronic
1136071572 16:27790813-27790835 CTCCTTGAGGAGTAATGGGGTGG + Exonic
1140995267 16:80252785-80252807 CTATTTTAGGGGTGATGGTGGGG + Intergenic
1144805655 17:17965235-17965257 ATATTTTAGAGGTACTGGGGAGG - Intronic
1150070718 17:62147689-62147711 CTTCTTAAGGGGGGATGGGGCGG - Intergenic
1158057247 18:53296319-53296341 CTACTTTAAGGGAAACTGGGAGG - Intronic
1162343171 19:10104751-10104773 CAACTTAAAGGGAAATGGGGTGG + Intergenic
1162944021 19:14031662-14031684 CTGCTTGAGGGGGAGTGGGGAGG - Intergenic
1165068904 19:33243977-33243999 CTACTTAAGGAGTAGTGTGGTGG - Intergenic
926548912 2:14277188-14277210 CTACTTGAGGGTGAATGGTGAGG - Intergenic
931748705 2:65312654-65312676 CTACTTTAGGGGTAATGGGGAGG + Exonic
933035320 2:77389729-77389751 CTGCTTGTGGGGTGATGGGGTGG - Intronic
934548724 2:95241115-95241137 CTGCTTTGGGGGCAGTGGGGTGG - Intronic
937582576 2:123505172-123505194 CTACTGTAGAGGTAATTGGTTGG + Intergenic
938892265 2:135717569-135717591 CTACTTGAGGGGAAAGGGTGAGG + Intronic
940044027 2:149390397-149390419 CTGGTTTAGGGGATATGGGGAGG + Intronic
941528365 2:166633082-166633104 CTACTATTGGGGGATTGGGGAGG + Intergenic
944466666 2:200008304-200008326 CTATTTTAAGGTTAATTGGGTGG - Intronic
1169331814 20:4722159-4722181 CTACTTTAGGGTTTGTGGGTTGG + Intronic
1169828690 20:9798104-9798126 CTACTTCAGTGGCAATGTGGGGG + Intronic
1172943478 20:38670714-38670736 CAGCTTGAGAGGTAATGGGGAGG - Intergenic
1174372510 20:50101976-50101998 TTACCTTAAGGGTAATCGGGGGG + Intronic
1178967021 21:37130311-37130333 TTTCTTTAGGGGTACAGGGGAGG - Intronic
1183687515 22:39369718-39369740 CCACTCTAGGGGTGATGGTGAGG + Intronic
950557139 3:13702675-13702697 CTACTGTGGGGGTTATGTGGAGG + Intergenic
953754427 3:45634383-45634405 CTACTGTAGGGGTTCTGGGCTGG + Intronic
954276751 3:49547152-49547174 CTGGTTTAGGGGTGATGGTGTGG - Intergenic
958597415 3:96245444-96245466 CTACTTCTGGGGTAATGGAGGGG - Intergenic
958693211 3:97494802-97494824 CTATTTGAAGGGTAATGGTGTGG - Intronic
958864272 3:99482923-99482945 CTTCTTTAGGGGAAAAGGGTAGG - Intergenic
961118341 3:124350878-124350900 CTAATTTCAGGGTAATGGGATGG - Intronic
964992888 3:162835868-162835890 CACCTTCAGGGGCAATGGGGAGG + Intergenic
967973600 3:195017486-195017508 CTACTCTTGGGGTAATTGTGGGG - Intergenic
974286312 4:59872210-59872232 TTACTTTATGGGTAAAGGGTTGG - Intergenic
975968738 4:80008014-80008036 CTACTTTTGGAGTAATGACGAGG - Intronic
982907623 4:161096073-161096095 ATACGTTAGGGGTAATTGTGGGG - Intergenic
984583624 4:181537960-181537982 ATACGTTAGGGGGAATGGGAAGG + Intergenic
987056631 5:14199683-14199705 CTACTTTAGGATAAAAGGGGAGG - Intronic
996428155 5:123337313-123337335 AAACTTTAGGGGTAATGGATAGG - Intergenic
998305741 5:141075063-141075085 ATACTTTAAGGCCAATGGGGTGG + Intergenic
1001023173 5:168201041-168201063 CTACTTGAGGGGTTATTGAGAGG - Intronic
1009444291 6:63722291-63722313 CTAGTTGAGGTGGAATGGGGTGG - Intronic
1009865746 6:69395620-69395642 CTTCTTGAAGGGTAATGTGGTGG + Intergenic
1012347156 6:98204170-98204192 CTACTTTATGTGCAATGGGGAGG - Intergenic
1018410414 6:163539539-163539561 CACCTTTAGGGGTAATGGAAAGG - Intronic
1027186196 7:75972174-75972196 TTACTGTAGGGGAAATGGGAAGG + Intronic
1029470897 7:100753378-100753400 CGACTTCAGAGGAAATGGGGAGG + Intronic
1034601779 7:152264653-152264675 TTTCTTAAGGGGTACTGGGGAGG - Intronic
1039631140 8:39112696-39112718 GTACTTTGGGGGCAAGGGGGTGG - Intronic
1045486401 8:102634879-102634901 CCACTCTATGGGTAATGGGGTGG + Intergenic
1046947867 8:119991278-119991300 CTACATGAGGGGTAAGGTGGAGG - Intronic
1048117707 8:131544013-131544035 TCACTTAAGGGGTAATGGGGGGG - Intergenic
1048648255 8:136446313-136446335 CTACTATATGTGTAATGAGGAGG + Intergenic
1050735257 9:8754864-8754886 ATCCTTTTGGGGAAATGGGGTGG + Intronic
1058077885 9:100668874-100668896 CTTTTTTAGGGGTGATGGTGGGG - Intergenic
1201716906 Y:17054930-17054952 CTAATTTAGGGGTTTTGGGGTGG - Intergenic