ID: 931748869

View in Genome Browser
Species Human (GRCh38)
Location 2:65313789-65313811
Sequence TCAACCACGAGGAGAACCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748869 Original CRISPR TCAACCACGAGGAGAACCGC CGG (reversed) Exonic