ID: 931748869

View in Genome Browser
Species Human (GRCh38)
Location 2:65313789-65313811
Sequence TCAACCACGAGGAGAACCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931748869 Original CRISPR TCAACCACGAGGAGAACCGC CGG (reversed) Exonic
904732679 1:32606774-32606796 TCACCCAAGAGGAGACCTGCAGG + Intronic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
1067564579 10:47327294-47327316 TCAACCACGGGGAGAGGCCCTGG - Intergenic
1076891489 10:133286474-133286496 CTAACCACGGAGAGAACCGCCGG + Intronic
1083838979 11:65292287-65292309 GCAAACAGGACGAGAACCGCGGG - Intronic
1084796031 11:71504621-71504643 GCACCCACGAGGAGAACAGGAGG - Intronic
1102677080 12:114666116-114666138 TGAACCGCGAGGGAAACCGCGGG - Intergenic
1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG + Intronic
1120852237 14:89181711-89181733 TTACCTAAGAGGAGAACCGCAGG + Intronic
1132491501 16:234431-234453 TTGACCACGAGGAGAATTGCTGG - Intergenic
1144210818 17:13013852-13013874 TCAACGACGAGAAGCACCTCTGG + Intronic
1145103405 17:20095570-20095592 CCAGCCACGAGAAGAACCACAGG - Intronic
1166181394 19:41111729-41111751 TCAACCCAGTTGAGAACCGCTGG - Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG + Intergenic
937091643 2:119210387-119210409 TCAACCAAAAGGAGAACTCCTGG + Intergenic
946385439 2:219381560-219381582 ACAAGCATGAGGAGAACCACCGG - Exonic
948893221 2:240916930-240916952 CCAACCAGGAGGAGAGCTGCTGG - Intergenic
1177098327 21:16867476-16867498 TCAACCACAAGGATACCTGCAGG + Intergenic
1177117316 21:17102077-17102099 TCAACTAGGAGGAGAAACACTGG + Intergenic
1185065322 22:48629124-48629146 TCCACCTCGAGGGGAGCCGCTGG - Intronic
951984938 3:28608564-28608586 CCAACCAGGAGCACAACCGCTGG - Intergenic
962207350 3:133445983-133446005 TCAACCAGAAGGAGAACTCCAGG + Intronic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
971595589 4:28523971-28523993 TCAACCTGGAGGAGAACAGATGG + Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1007930552 6:45687003-45687025 TCACCCACCAGGAGAACGGGAGG - Intergenic
1026063335 7:67046266-67046288 TCAACCACAAGCAGAACCAAAGG - Intronic
1026715008 7:72781231-72781253 TCAACCACAAGCAGAACCAAAGG + Intronic
1028649341 7:93133561-93133583 TCATCCACAAGGAGAAGCACAGG + Exonic
1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG + Intergenic
1060449698 9:123725575-123725597 TTAACCACGAGCAGAACTGCAGG + Intronic
1062086680 9:134652768-134652790 TACACCATGAGGAGAAACGCTGG - Intronic
1186165697 X:6823925-6823947 TCAGCCATGAGGAGGACCGGAGG + Intergenic
1196896193 X:120338967-120338989 TCAAAGACGAGGAGAACATCTGG - Intergenic