ID: 931755616

View in Genome Browser
Species Human (GRCh38)
Location 2:65371619-65371641
Sequence CTATGTTTCTTAAAGTGTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931755615_931755616 28 Left 931755615 2:65371568-65371590 CCTTCAGTACACACAGTGACAAA 0: 1
1: 0
2: 1
3: 15
4: 229
Right 931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG 0: 1
1: 0
2: 3
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931755616 Original CRISPR CTATGTTTCTTAAAGTGTAA CGG Intronic
901349187 1:8577623-8577645 CAATGTTTCTGAAAGTGAATAGG + Intronic
902102823 1:14006906-14006928 CTATGTTGCTTTGAGTGTTAAGG + Intergenic
903946311 1:26966001-26966023 GTTTGTTTTGTAAAGTGTAAAGG - Intergenic
904227239 1:29032208-29032230 GTATGTTTCTAAAACTGAAATGG + Intronic
904844444 1:33398552-33398574 CTATGTATCTTAAAGTATCTGGG + Intronic
906805289 1:48774861-48774883 ATAAGTTTCTTAGTGTGTAATGG - Intronic
907738144 1:57136333-57136355 CTGTGTTTCTTATAGTGTAATGG - Intronic
908736895 1:67285943-67285965 TTATGGTTGTGAAAGTGTAAAGG - Intergenic
908873236 1:68638876-68638898 CAATGTGCCTTAAAGTGAAATGG - Intergenic
909020695 1:70427665-70427687 CTATGTTTAGGAAAATGTAAAGG + Intronic
909534498 1:76721160-76721182 CTATGTCACCTAAAGTGCAAAGG + Intergenic
909732561 1:78912761-78912783 CAATTTTTTTTAAAGTGTAGGGG - Intronic
911289214 1:96035969-96035991 CTATGATTCTTACAGTATGAAGG + Intergenic
912030656 1:105239289-105239311 CGATGTGGCTAAAAGTGTAAAGG + Intergenic
913182366 1:116334402-116334424 CTATTTTTACTAAAGTGTGAAGG + Intergenic
913432476 1:118810383-118810405 ATTTGTTTCTTAAAGTTTTATGG + Intergenic
915843418 1:159236901-159236923 ATATATTTTTTAAAGGGTAAAGG + Intergenic
916891930 1:169120493-169120515 CTCTGTTACTTAAAATGGAAAGG + Intronic
920544244 1:206802226-206802248 CCATGTGTTTTAAAGTCTAATGG - Intronic
923509284 1:234635625-234635647 ATGTGTTTTATAAAGTGTAAAGG + Intergenic
924397407 1:243636880-243636902 CAAAGTTTCACAAAGTGTAAGGG + Intronic
1062793600 10:325448-325470 CTTTGTCTCTTAAAATGTCAAGG - Intronic
1064273953 10:13890316-13890338 CTAAGTTTCATGAAGTCTAAGGG + Intronic
1064795123 10:19003708-19003730 GCATATATCTTAAAGTGTAATGG + Intergenic
1064929266 10:20605613-20605635 CTATGTTTTGTAAAATGTAGAGG - Intergenic
1066195540 10:33095947-33095969 CTCTGTTTCTGTCAGTGTAACGG + Intergenic
1067609809 10:47701990-47702012 ATATGTTTCTCAAAGGGGAATGG + Intergenic
1068221087 10:54046805-54046827 TTTTTTTTCTTAAAGTTTAAAGG + Intronic
1068913693 10:62406002-62406024 CCAAGATTCTTAAAGGGTAAGGG + Intronic
1071155879 10:82688357-82688379 CGATGTTTGTTAAAGTGTTTTGG + Intronic
1071625401 10:87163598-87163620 ATATGTTTCTCAAAGGGGAATGG + Intronic
1073947448 10:108767375-108767397 CTGTGTTTCTTAAAGTAATAAGG + Intergenic
1075098916 10:119492198-119492220 CTCTGTTTTTTAAACTGTTATGG - Intergenic
1075168062 10:120087216-120087238 CTATGTTTCTTGACCTGAAAGGG + Intergenic
1075617386 10:123901114-123901136 CTATTTTTCTTACTGTGTAAGGG - Intronic
1075987791 10:126803093-126803115 ATATGTTTCTAAAAGTAGAAAGG - Intergenic
1077600913 11:3573863-3573885 CAATGTTGCTGGAAGTGTAATGG - Intergenic
1077749288 11:4946596-4946618 TCAAGTTTCTTAAAGTGAAAGGG + Exonic
1078505814 11:11943811-11943833 AAATCTTTCTTCAAGTGTAAAGG + Intronic
1081371421 11:42309107-42309129 CTATGTTTCAGAAACTGTGAAGG + Intergenic
1083069886 11:59967052-59967074 CCATGTTCCTAAAGGTGTAAAGG - Intergenic
1085922805 11:80979157-80979179 CTGTGGTTCTTAAAATATAAAGG - Intergenic
1086258213 11:84905759-84905781 CTATGTCTCTTAAACTTTACAGG + Intronic
1086952053 11:92900716-92900738 CTATATTTCTTACCATGTAATGG + Intergenic
1088918484 11:114244788-114244810 CTTTGTTTTTTAAATTGTTAGGG + Intronic
1088970168 11:114767193-114767215 CTATTATTCATAAAGTATAAAGG - Intergenic
1090530935 11:127591138-127591160 TTAATTTTCTTAGAGTGTAACGG + Intergenic
1094724524 12:33100108-33100130 ATTTGATTCTTAAATTGTAATGG - Intergenic
1098614385 12:72505318-72505340 CTTGTATTCTTAAAGTGTAATGG + Intronic
1098813328 12:75124250-75124272 GTATGTTTTTTAAAGTTAAAAGG + Intronic
1099340565 12:81427073-81427095 TTATGTCTCTTTCAGTGTAATGG + Intronic
1099755020 12:86834639-86834661 CTGTGTTTCCTAATCTGTAAAGG - Intronic
1107807024 13:44162949-44162971 CCATGTTTTATAAAATGTAAAGG + Intergenic
1107826376 13:44332302-44332324 GTATTTATCTTAAAGTGAAAAGG - Intergenic
1107881209 13:44833578-44833600 CAATTTTTCTTAAATAGTAAAGG - Intergenic
1108950050 13:56080756-56080778 CTGTGTGTCTTAAAGTAAAAAGG - Intergenic
1109444082 13:62410388-62410410 ATATGTTTCTTAAAAGGAAATGG - Intergenic
1109759041 13:66802650-66802672 CTATAATTTTTAAAGTTTAATGG - Intronic
1109836842 13:67870798-67870820 CTGTTTTTCTTAAACTATAATGG + Intergenic
1110910207 13:80951108-80951130 CTTTTTTTCTAAAATTGTAATGG - Intergenic
1111438932 13:88252296-88252318 TTGTGTTTCTGAAAATGTAAAGG + Intergenic
1112248467 13:97756065-97756087 CTAGATTTTGTAAAGTGTAATGG + Intergenic
1112458372 13:99582183-99582205 CCATGTTTCTGGAAGTGAAAGGG + Intergenic
1112923767 13:104648294-104648316 ATATGTTTCTAAAAGCATAAGGG + Intergenic
1113178364 13:107594955-107594977 CTATGGATCTGAAAGTGTACAGG - Intronic
1114419264 14:22566694-22566716 TTATATTTCTAAAAGTGTCAAGG - Intronic
1115387103 14:32810521-32810543 CTATGTTTTTTAACGTGTCTAGG + Intronic
1115860955 14:37685847-37685869 TTATATTTTTTTAAGTGTAAGGG + Intronic
1116618575 14:47170391-47170413 CTATGTGTCTGAAACTGTACAGG + Intronic
1116962206 14:50978072-50978094 TTTTCTTTCTTAAAGTGTAGAGG + Intronic
1117237455 14:53793383-53793405 CTCTGTTTCTTCACCTGTAAAGG + Intergenic
1117772245 14:59145516-59145538 CTATGGTTCTTAAAAAGTATAGG + Intergenic
1119969436 14:78952893-78952915 CTCTGTTTCCAAAAGTGTATGGG - Intronic
1122513923 14:102292727-102292749 TTTTGTTTCTCTAAGTGTAATGG - Intronic
1123913387 15:24994101-24994123 TTATGTTTGTTGAAGTGAAATGG + Intergenic
1126133651 15:45369259-45369281 ATTTCTTTCTTAATGTGTAAGGG - Intronic
1126468708 15:48984188-48984210 CTATGTTGCTTAAACTCTGAAGG - Intergenic
1126984735 15:54291905-54291927 ATATGTATTTTAACGTGTAAGGG + Intronic
1127306246 15:57708107-57708129 CAATAATTCTTAAAGTATAACGG - Intronic
1130758281 15:86789732-86789754 CTATGTTTTTGAAAGAGTAGGGG + Intronic
1133899974 16:9964836-9964858 ATATGTTGCTTATAGTGTAAAGG - Intronic
1134284402 16:12847809-12847831 CAATGTTTCCTAAAGAGTACTGG - Intergenic
1134500992 16:14769137-14769159 CTAGGTTTCTTCATGTGAAATGG + Intronic
1134579591 16:15359913-15359935 CTAGGTTTCTTCATGTGAAATGG - Intergenic
1134715114 16:16354285-16354307 CTAGGTTTCTTCATGTGAAATGG + Intergenic
1134722992 16:16397646-16397668 CTAGGTTTCTTCATGTGAAATGG + Intergenic
1134944436 16:18314225-18314247 CTAGGTTTCTTCATGTGAAATGG - Intergenic
1134951701 16:18354375-18354397 CTAGGTTTCTTCATGTGAAATGG - Intergenic
1137011848 16:35329178-35329200 CTATGTTTCAAAAACTTTAAGGG - Intergenic
1138186418 16:54981200-54981222 CTCTGTTTCTTCATCTGTAAGGG + Intergenic
1140988721 16:80186875-80186897 CTATGTTTCCTAAAGTTTGAGGG + Intergenic
1144325624 17:14176927-14176949 CTATGTTGCTTAAAATGTAAAGG - Intronic
1144474502 17:15573816-15573838 CTATGTTGCTTAAAATGCAAAGG - Exonic
1149328033 17:55552844-55552866 GTATATATGTTAAAGTGTAAAGG - Intergenic
1149419552 17:56495847-56495869 ATATTTTTATTAAAATGTAAAGG - Intronic
1149735366 17:58988627-58988649 TGCTGTTTCTTGAAGTGTAACGG - Intronic
1152881837 17:82821660-82821682 CCATGTCTTATAAAGTGTAATGG + Intronic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1153730234 18:8003854-8003876 CTAAGTTTCTTTAAGTAGAATGG - Intronic
1154319789 18:13338509-13338531 GAATGTTTCTGAGAGTGTAAAGG + Intronic
1156091357 18:33474906-33474928 CTTAGTTTCTTAATCTGTAAAGG + Intergenic
1156127920 18:33930247-33930269 CTATGTTTATAAAAATATAATGG + Intronic
1159493626 18:69171384-69171406 TTAGGTTTGTTGAAGTGTAATGG + Intergenic
1159749976 18:72288092-72288114 CACTGTTTCTTAAAATGAAAGGG - Intergenic
1159856335 18:73594020-73594042 ATATATTTCATAAAGTGAAATGG + Intergenic
1162737119 19:12752851-12752873 CTATGTTTTTTAAACTGAGATGG + Intronic
1163814926 19:19458976-19458998 CCATGTTTCTTAAAGAAAAAAGG - Intronic
1164532346 19:29058065-29058087 ATAGGTTTCTTAAAGTGAGAGGG - Intergenic
1168115474 19:54219726-54219748 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168121278 19:54253875-54253897 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168124786 19:54277407-54277429 CTCAGTTTCTCCAAGTGTAAAGG - Intronic
1168132819 19:54332033-54332055 CTCAGTTTCTCCAAGTGTAAAGG - Intergenic
1168181502 19:54665301-54665323 CTCAGTTTCTCCAAGTGTAAAGG + Intronic
926798058 2:16635055-16635077 CTAAGTTTCCTTAACTGTAAAGG + Intronic
927387563 2:22553017-22553039 ATATTTTTTTTAAAGAGTAAAGG + Intergenic
931755616 2:65371619-65371641 CTATGTTTCTTAAAGTGTAACGG + Intronic
935217989 2:100989376-100989398 CCATCTTTCTTCAAATGTAAGGG + Intronic
939169829 2:138681981-138682003 CTATAATTCTTCAACTGTAAAGG - Intronic
939858670 2:147391778-147391800 CCAAGTTTCTTGAGGTGTAAAGG + Intergenic
939889719 2:147722136-147722158 ATATTTTTCTTAAAATGTCATGG - Intergenic
940032274 2:149276273-149276295 CTACTTTTCTTTAAGAGTAACGG - Intergenic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
940548957 2:155127319-155127341 GTATGTTTCTAAGAGTGTACAGG + Intergenic
940835069 2:158511972-158511994 CTCAGTTTTTTAAAGTGTTATGG + Intronic
940963708 2:159814273-159814295 ATATGATCCTTAAAGTTTAAGGG - Intronic
946100618 2:217317483-217317505 ATATGTTTCTTCAGGTGTTAAGG + Intronic
946639824 2:221772381-221772403 TTATGTTTCTTAAATTAAAATGG - Intergenic
946809874 2:223512410-223512432 CTATGTGTCTAAAAGTGTTTTGG - Intergenic
1169628107 20:7595683-7595705 CTATGTTTCTTAAAGGATACAGG + Intergenic
1175453435 20:59090568-59090590 CTATGTATCTAAGAGTGTAATGG + Intergenic
1175674955 20:60938383-60938405 CTATTCTTCTCAAAGTGAAAGGG + Intergenic
1177806716 21:25882289-25882311 TTATGTTTGTTAAAATGTTAAGG + Intronic
1178213156 21:30560866-30560888 CAATCTTTCTTAGAGTATAATGG + Exonic
1178860308 21:36283463-36283485 TTATGTCAGTTAAAGTGTAAAGG - Intronic
1179200840 21:39219073-39219095 CTAATTTTCTTAAATTTTAAGGG + Intronic
1182760274 22:32717127-32717149 CTCAGTTTCTTCATGTGTAAAGG - Intronic
1183969011 22:41461959-41461981 CTATGGTATTTAAAATGTAAGGG - Intronic
1184626973 22:45742587-45742609 TGATGTATCTTAAAGTGTACTGG - Intronic
951662323 3:25082508-25082530 CTATATTTCTCCAAGTATAATGG + Intergenic
953742983 3:45552794-45552816 CTATGGATCTCACAGTGTAAAGG - Intergenic
953819227 3:46189884-46189906 CTATGGTTCTCAAACTGTAGGGG - Intronic
956073476 3:65479610-65479632 CTTTTTTTCTTAAATTCTAAAGG - Intronic
956395875 3:68825644-68825666 CTAGGTTTATTAAAGAGTAAAGG - Intronic
956828475 3:73021054-73021076 CTATGTTGCTTAATGTTTACTGG + Intronic
957164422 3:76653520-76653542 TTATATTTCTTAAAGTGAAATGG + Intronic
957438512 3:80211515-80211537 CTATTTATCTTAAACTTTAAGGG - Intergenic
958656855 3:97013451-97013473 ATATGTTTATTAAGGTGTGATGG + Intronic
961101074 3:124199619-124199641 CCTTTTTTCTTAAAGAGTAAAGG + Intronic
962538047 3:136349126-136349148 AATTGTTTCTTATAGTGTAAAGG + Intronic
964555880 3:157937984-157938006 CTATTTTTGTTAAAATGTATTGG + Intergenic
966033748 3:175383785-175383807 CTCTGTTCATTAAAGAGTAAGGG - Intronic
966201435 3:177362439-177362461 CAATGCTTCTTAAACTGTCATGG + Intergenic
966401072 3:179547225-179547247 CTGTGGTTCTTAAAGAGTAGAGG - Intergenic
966405515 3:179593323-179593345 CTATTTTTTTTAAAGTCTCAGGG - Intronic
967056327 3:185832129-185832151 CCATATTTCTTAAATTATAATGG + Intergenic
967642347 3:191880482-191880504 CAAAGTTGCTTAAACTGTAAGGG - Intergenic
968220665 3:196936697-196936719 CTGTCTTTCTAAAAGTGTAGTGG + Exonic
969546052 4:7828737-7828759 CTCTGTTTCTTCATCTGTAAAGG - Intronic
969806314 4:9611685-9611707 GTAGATTTCTTAAAGTTTAATGG + Intergenic
969951819 4:10844664-10844686 ATGTGTTTGTTAAACTGTAATGG + Intergenic
971448601 4:26778811-26778833 CAGTGTTTCTTAAATTGTAATGG - Intergenic
971774470 4:30944475-30944497 CTATAATTTTTAAAGTGTAAAGG + Intronic
971943457 4:33244803-33244825 ATATTTTCCCTAAAGTGTAATGG - Intergenic
972113069 4:35590684-35590706 CTATGTTTCATGAAGTATAGTGG + Intergenic
974557593 4:63471762-63471784 CAATGTTTCTTAAAGTTCAGTGG + Intergenic
975065322 4:70055679-70055701 CTACATTTCTTAAACTGGAATGG - Exonic
975265751 4:72364689-72364711 CAATGTTTATTAATGTATAAAGG + Intronic
976019895 4:80609463-80609485 GTTTATTTATTAAAGTGTAAAGG + Intronic
977042654 4:92033911-92033933 CTTGTTTTCTTAAAGTCTAAAGG - Intergenic
978133647 4:105230919-105230941 GAATTTATCTTAAAGTGTAAGGG + Intronic
978369439 4:108015736-108015758 CTATGTTTCTTGAAGTGTGTAGG + Intronic
979574120 4:122266255-122266277 GTATGATACTTAAAATGTAAAGG + Intronic
979872909 4:125848807-125848829 CTATGTTTGTTAAAAAGTAGGGG + Intergenic
980305726 4:131059393-131059415 CTATGTTTTTTTAATTTTAAAGG + Intergenic
981509544 4:145540769-145540791 GTATCTTTCTTAAAGTCTACTGG - Intronic
983984897 4:174046758-174046780 ATATGTTTTTGAAAGTATAATGG + Intergenic
985219513 4:187689009-187689031 CAATATTTTTTAAAGTGAAAAGG - Intergenic
987906532 5:24084918-24084940 CTATTTATGGTAAAGTGTAATGG + Intronic
987948112 5:24640794-24640816 CAATGTCTCTTAAAGTGTATAGG + Intronic
988333208 5:29870140-29870162 CTGTGTTTCTCACTGTGTAATGG + Intergenic
988877319 5:35461380-35461402 CTGAATTTCTTAAACTGTAAAGG - Intergenic
990946648 5:61256326-61256348 CCATCTTTATTAAAGTGTATAGG + Intergenic
993052465 5:82941260-82941282 TAATCTTTCTTGAAGTGTAATGG + Intergenic
993458428 5:88153032-88153054 TTATGTTTCATAATGTGAAATGG + Intergenic
993664702 5:90681670-90681692 TTATGTTCCTTAAAGGGTCAAGG - Intronic
999326391 5:150646812-150646834 CTATAATTCTGAAAGTATAAAGG + Intronic
1000112399 5:158121348-158121370 CTTTGTTTCTTAACATGCAAAGG + Intergenic
1000822530 5:166002161-166002183 TTGTCTTTCTTAAAGTATAATGG - Intergenic
1003204973 6:4000182-4000204 CTATGTCTATTAATATGTAATGG + Intergenic
1003448066 6:6203317-6203339 CTATGTTGCTTTATGTGTCAAGG + Intronic
1003997528 6:11557914-11557936 CTATTTTTTTTAAAGTGACAGGG + Intronic
1004825683 6:19418147-19418169 CAATTTTTGTTAAAGTGTACAGG + Intergenic
1005067796 6:21835392-21835414 CTATATGTCTGAAAGTGTATGGG - Intergenic
1006687665 6:35850689-35850711 CTATGATTCTTAAATAGGAAAGG - Intronic
1007949271 6:45856193-45856215 CTATTTTTTTTTAAGTGAAATGG - Intergenic
1009326166 6:62350041-62350063 TTATGTTCCTTAAAGAGAAAGGG + Intergenic
1009354396 6:62723531-62723553 CAATATTTCTTAAAGTTGAAAGG + Intergenic
1009503481 6:64446512-64446534 ATATATTTTTGAAAGTGTAAAGG + Intronic
1010274606 6:73954827-73954849 CACTGTTTCTTAAAGTATGATGG + Intergenic
1010340953 6:74751976-74751998 ATTTGTTTCTTATACTGTAAAGG - Intergenic
1013389929 6:109674785-109674807 CTATGTTTCTAAAAACATAATGG - Intronic
1013413521 6:109903803-109903825 CTATGTGACTAAAAGTGTACTGG - Intergenic
1013954420 6:115824232-115824254 CTAAGTTTCTTCAACTGTAAAGG + Intergenic
1016863025 6:148740562-148740584 CTATTTTTCCTGAAGTATAATGG - Intergenic
1018997638 6:168722390-168722412 TAATGCTTCTTAAAGTGGAAGGG + Intergenic
1020686433 7:11301579-11301601 ATATGTTTGTTTAAATGTAATGG + Intergenic
1021659217 7:22902634-22902656 TTATTTTTTTTAAAGTGTCAAGG + Intergenic
1022380807 7:29858128-29858150 TTTTGGTTCTTAAAGTGAAATGG + Intronic
1022480770 7:30741649-30741671 CTCAGGTTCTTAAAGTGGAAAGG - Intronic
1022707815 7:32821718-32821740 TTATCTTTCTTAAAGGGTAAGGG + Intergenic
1022819173 7:33942193-33942215 CGGTGTTTCTCAAAATGTAACGG + Intronic
1022915148 7:34941618-34941640 TTATCTTTCTTAAAGGGTAAGGG - Intronic
1025002053 7:55324559-55324581 GTCTGTTTCTTTAAATGTAAAGG + Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026218167 7:68367958-68367980 CTATGTTTCTTATTGTGCTATGG + Intergenic
1027289627 7:76691238-76691260 CAATATTTCTTAAAATGTTATGG + Intergenic
1027520753 7:79203818-79203840 CTTTGTTTCTTAATGTGCCAAGG + Intronic
1029604225 7:101589010-101589032 CTATTTTTCGTAAATTGCAAGGG + Intergenic
1031059762 7:117037666-117037688 CTATGCTTCTGAATGTGTGAGGG + Intronic
1032643082 7:133791560-133791582 CTATGCTTATTAAACAGTAATGG - Intronic
1033884021 7:145922056-145922078 GTATGTTTTTAAAAATGTAAAGG + Intergenic
1034105445 7:148486055-148486077 CTGTTTTTCTTAAATTGTTATGG + Intergenic
1034625113 7:152486536-152486558 CAATGTTTCTTAAAGTATGGTGG - Intergenic
1036019698 8:4830743-4830765 TTATATTTCTTAAAGTCCAATGG - Intronic
1036038994 8:5053266-5053288 CTTTGCTTGTCAAAGTGTAATGG - Intergenic
1038029432 8:23624263-23624285 CAGTGTTTCTCAAATTGTAATGG + Intergenic
1039623823 8:39026855-39026877 CCATGTTTCTTACACTGTGAGGG + Intronic
1041286644 8:56269472-56269494 CTATGTTAATGAAAGTCTAAGGG - Intergenic
1041441904 8:57906200-57906222 CTATGTTTGTTTAAGAGTCATGG - Intergenic
1041790194 8:61687176-61687198 CTATCTCTCTTAAAGGGAAATGG + Intronic
1042424069 8:68625516-68625538 CTTTGTGGCTTGAAGTGTAAGGG + Intronic
1046440880 8:114252710-114252732 CTTTTTTTCTTATAGTATAAAGG + Intergenic
1050584037 9:7091482-7091504 ATATATTTCTTAAAGTATAGGGG - Intergenic
1052159519 9:25239381-25239403 CTATTTTTCTTAAAGGGTAATGG + Intergenic
1052277154 9:26689848-26689870 ATTTGTTTCTTAAAGTGTTTTGG - Intergenic
1052303118 9:26975274-26975296 CTCTGGTTTTTAAAGGGTAAAGG + Intronic
1052405964 9:28061196-28061218 GTATGTTTCTTAATGAGTGAAGG + Intronic
1052628161 9:31003440-31003462 CCATGTTTCTGAAAATGTCAGGG - Intergenic
1052642219 9:31183022-31183044 CTATATTTATAAAAATGTAATGG - Intergenic
1053367404 9:37532948-37532970 CTTTGTTTTATAAAGTGGAAGGG - Intronic
1056500901 9:87208164-87208186 CTATTTTTCTCAAAATGAAAAGG - Intergenic
1059266433 9:113036348-113036370 CTATGGTTCTTCAAGTTGAAAGG - Intergenic
1060221608 9:121766937-121766959 GTATGTTTCTTAATTTTTAAAGG + Intronic
1060672900 9:125485926-125485948 CTATTTTTCTTCTAGTGTCAGGG + Intronic
1061887543 9:133599476-133599498 CTATGTGTGTCAATGTGTAAGGG + Intergenic
1186391807 X:9168220-9168242 TTATGTTTCTAAAACTGGAAAGG - Intergenic
1188527598 X:31103067-31103089 GTTTTTTTCTTGAAGTGTAAAGG - Intronic
1188848067 X:35098696-35098718 CTATGTTTCTAATAGTAAAATGG - Intergenic
1189734432 X:44055138-44055160 CTCTGCTTCTGAAAGTGAAATGG + Intergenic
1193241365 X:79174086-79174108 ATATTTTTCTTAAAGAGGAAGGG + Intergenic
1198625567 X:138569213-138569235 CTATGCTTCCTAAACTTTAATGG + Intergenic