ID: 931757753

View in Genome Browser
Species Human (GRCh38)
Location 2:65388999-65389021
Sequence ACAGAGATTCTGTACTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931757753 Original CRISPR ACAGAGATTCTGTACTGGGA GGG Intronic
901394295 1:8969459-8969481 AGAGACATTGTGTACTGGAAAGG + Intronic
904035244 1:27555526-27555548 AGAGAGATCCTGACCTGGGAGGG - Intronic
905506242 1:38481749-38481771 ATGGAGCTTCTGTTCTGGGAGGG - Intergenic
908582191 1:65527401-65527423 ACAGTGAGTATGTACTGTGAAGG + Intronic
916322592 1:163521704-163521726 ACGGATATTCTGTAGTGGTATGG - Intergenic
916677299 1:167074723-167074745 AGGGAGATTGTGTAGTGGGAGGG + Intronic
923521967 1:234741950-234741972 ACAGAAATTCCTGACTGGGATGG + Intergenic
924060492 1:240169265-240169287 CGAGATATTCTGTAATGGGATGG + Intronic
1069287646 10:66736140-66736162 ATTGAGATTCTGTACTGTCATGG + Intronic
1073263218 10:102206342-102206364 ACAGAAATTCTGTACTTGTGAGG - Intergenic
1074900087 10:117808797-117808819 ACAGAGCTTCTGTAGTCGAAAGG + Intergenic
1075278522 10:121118127-121118149 ACAGATATACTGTAGAGGGAGGG + Intergenic
1076252432 10:128995102-128995124 ACACAGATGCTGCACTGGGCTGG + Intergenic
1078462275 11:11523253-11523275 AAAGAGATGCTGTACTTGGAGGG - Intronic
1079350137 11:19685207-19685229 GCAGAGCTTCTGAACTGAGAGGG - Intronic
1079525924 11:21387513-21387535 ACTGAGATTATGTACTGGTAAGG + Intronic
1080074046 11:28126998-28127020 ACAAAAGTTCTGTGCTGGGAAGG + Intronic
1080264672 11:30388405-30388427 CCAAACATTCTGTGCTGGGAAGG + Intronic
1080880173 11:36312356-36312378 ACAGGGGTTGTGTACTCGGAAGG + Intronic
1082640552 11:55654777-55654799 ACAGAGTGTCTATACTGGCAAGG - Intergenic
1082781936 11:57294731-57294753 ACAGGGGCTCTGTGCTGGGAGGG - Intergenic
1083254705 11:61489016-61489038 ACAGAGAGTCTGAGCTGGAAGGG + Intronic
1086614223 11:88795442-88795464 ACAAAGATACTCTACTAGGATGG + Intronic
1086954174 11:92918651-92918673 TCAGAGTTTCTGGAATGGGATGG + Intergenic
1086985580 11:93245406-93245428 AAAGAGATTCTGGGCTGAGATGG - Intergenic
1088954055 11:114600441-114600463 ACACAAATGCTGTACTGAGAAGG + Intergenic
1089049248 11:115531870-115531892 ATGGAGATTCTGTACTTAGAGGG - Intergenic
1089416003 11:118291191-118291213 ACAGTGATTCTTAACTGAGATGG + Intergenic
1089664670 11:120010643-120010665 CCAGAGATTCAGTAGTGTGAAGG - Intergenic
1090605381 11:128417840-128417862 ACAGAGTTTCTTGACAGGGAAGG - Intergenic
1090782991 11:130023778-130023800 ACAGAGAAGTAGTACTGGGAAGG + Intergenic
1093434805 12:19124321-19124343 GCAGAGATTCTGTGATGGGAAGG + Intergenic
1096045516 12:48558802-48558824 ACAGAAATGCTGAAATGGGAAGG + Intergenic
1097462577 12:59880634-59880656 ATGGACATTCAGTACTGGGATGG + Intergenic
1098469696 12:70829037-70829059 ACAGAGACTGTGGACTGTGATGG + Intronic
1100498154 12:95145319-95145341 GCAAAGATTCTGTACTGGTCAGG + Intronic
1102737165 12:115172557-115172579 ACAGAGATCATGTACAGAGAAGG - Intergenic
1102941494 12:116946596-116946618 ACAGTGGTTCTCGACTGGGAGGG - Intronic
1103058364 12:117839195-117839217 ACAGAAATTATGTCCTTGGAGGG - Intronic
1108959978 13:56214724-56214746 AAAGACATTCTGTTCTAGGAGGG - Intergenic
1108968985 13:56348330-56348352 GCAGAAATTCTATACTGGAAAGG + Intergenic
1109814093 13:67556401-67556423 ACAGAGATTCCTTCCAGGGAAGG + Intergenic
1113366418 13:109680850-109680872 ACAGAGATGGTGAACTGCGATGG - Intergenic
1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG + Intergenic
1115792126 14:36891910-36891932 ACAGAGATTCTGTGCTGACCTGG + Intronic
1116675181 14:47897652-47897674 ACAGAGCTTCTGCACTGCAAAGG + Intergenic
1117968175 14:61226899-61226921 AGAGAGATTTGGTAGTGGGAAGG - Intronic
1119939169 14:78622343-78622365 ACAGATCTTCTGTTCTGTGATGG + Intronic
1121531188 14:94654677-94654699 ACAGAGTTTCAGAACTGGGAAGG - Intergenic
1123980623 15:25598879-25598901 ACAGAGCCTCTGTAAAGGGAGGG + Intergenic
1127949785 15:63793746-63793768 ATAGAGGTTCTGTACTGGAAAGG - Intronic
1128013417 15:64320286-64320308 ATATTGATTCTTTACTGGGAAGG + Intronic
1129376116 15:75133145-75133167 GCTGAGATTGTGTAGTGGGATGG + Intergenic
1129804774 15:78446653-78446675 ACAGAGAGACTGAACTGGAAAGG - Intronic
1130193129 15:81755205-81755227 TCAGAGATTCTGGTCTGGAAAGG - Intergenic
1131018760 15:89080084-89080106 GCAGAGATTCTTTACAGGAAAGG + Intergenic
1134124601 16:11607939-11607961 ACAGGGGTTCTTAACTGGGAGGG - Intronic
1136666228 16:31815609-31815631 ACAAAGATTCTTTAGGGGGATGG + Intergenic
1140779698 16:78283265-78283287 ACAGAAATTCTCTGCTGTGAGGG + Intronic
1140946390 16:79771909-79771931 GCACAGATTCTGTACTTAGAAGG + Intergenic
1143755496 17:9064302-9064324 AGAGAGAATGTGTACAGGGAAGG - Intronic
1143961708 17:10726692-10726714 ACAGAGATGCAGTACTGGCCTGG - Intronic
1146419177 17:32666220-32666242 AGAAAGATTCTAGACTGGGAAGG - Intronic
1146473081 17:33139889-33139911 ACTGAGTTTCTGTACCGTGAAGG - Intronic
1147886167 17:43685825-43685847 TCAGAGATTCTGCTCTGGCAAGG + Intergenic
1149063686 17:52454951-52454973 ACAGTTATTCTGCAGTGGGAAGG + Intergenic
1151030092 17:70727492-70727514 ACAGAGTTTCTGTGCCAGGAGGG + Intergenic
1151185418 17:72360622-72360644 CCAGAGGATCTGAACTGGGATGG - Intergenic
1152085505 17:78215507-78215529 AATGAAATTCTGTACTCGGATGG + Intronic
1152235362 17:79135644-79135666 ACAGAGATCCTGTATGGGGGTGG - Intronic
1154073406 18:11176434-11176456 AAAGAGAGTCTGTACTCTGACGG - Intergenic
1156371822 18:36477862-36477884 GCAGAGTCTCTGGACTGGGATGG + Intronic
1163374817 19:16923494-16923516 AAAGAAATTCTGTACTGGGTGGG + Intronic
1165967988 19:39600545-39600567 AAAGAGCTTCTGTACAGTGAAGG + Intergenic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1167620814 19:50559475-50559497 ACTGTGATTCTGTGCTGGGATGG + Intronic
1168642426 19:58039043-58039065 ACGGAAATGCTGTAGTGGGAGGG - Intronic
925474179 2:4194168-4194190 CCAGATATTCTCTACTGGGCAGG - Intergenic
925970793 2:9105334-9105356 GCAGAGATGCTGTGCTGAGATGG - Intergenic
926742678 2:16125686-16125708 ACGGAGACTCTGGACTGGGCTGG - Intergenic
926784648 2:16507992-16508014 CCAGAGATTCTGTGCTGCAAGGG - Intergenic
927877625 2:26669422-26669444 ACAGGCATTCTATACTAGGAGGG - Intergenic
928170906 2:29002522-29002544 CCAGAGAGGCTGTACAGGGATGG - Exonic
928239024 2:29570494-29570516 TCAGAGATTCTGGATTGTGAGGG + Intronic
929253758 2:39786947-39786969 AAAGAGTGTGTGTACTGGGAGGG + Intergenic
929481162 2:42309547-42309569 ACAGATAATATGTACTGGCAAGG - Intronic
931163735 2:59722706-59722728 GCAGAGATACTGTGCTGGAAGGG + Intergenic
931285501 2:60828579-60828601 ACAGAGATGCTGGACTGTGGGGG - Intergenic
931757753 2:65388999-65389021 ACAGAGATTCTGTACTGGGAGGG + Intronic
932458402 2:71864772-71864794 ACAGTGTTTCTCAACTGGGAGGG - Intergenic
932565917 2:72909105-72909127 TTAGATGTTCTGTACTGGGAAGG + Intergenic
932691973 2:73921139-73921161 ACAGAGATCAAGTGCTGGGAGGG - Intergenic
932961405 2:76416238-76416260 CCAGGGATTCTGCATTGGGATGG - Intergenic
933188395 2:79304352-79304374 ACTAAGATACTGTTCTGGGATGG - Intronic
938161155 2:128985621-128985643 ACTGTGTTTCTGTCCTGGGAAGG + Intergenic
940057309 2:149526459-149526481 AGAGAGATTCTGCACTGTCATGG + Intergenic
941273090 2:163455038-163455060 TCAGAGATTCTGTTTTGGGTAGG + Intergenic
941418229 2:165248306-165248328 AGAGAAATACTGTAATGGGATGG - Intronic
941638977 2:167967282-167967304 GCAGAGATTGTGGGCTGGGAAGG - Intronic
942730858 2:179059147-179059169 ACAGGGCTTCTGTAGAGGGAAGG - Intergenic
943451834 2:188052158-188052180 ACAGAGATCATTTACTAGGAAGG - Intergenic
944445257 2:199782495-199782517 ACATAGCTTCTCTACTGGGAAGG + Intronic
946857085 2:223961500-223961522 CCAGAGATTATGTACTCTGAGGG - Intronic
947725798 2:232399546-232399568 ACAGCAATTCTGTCCTGGGTAGG - Intergenic
948034412 2:234846704-234846726 ACAGAGATTATGTGCGGGGAGGG - Intergenic
1170571360 20:17634587-17634609 CCAGAGCTTCTGGACTGGCAGGG + Intronic
1170847728 20:19976001-19976023 ACAGTGATTCTGTTCAGGGATGG + Intronic
1172993962 20:39056214-39056236 ACAGGGAGTCTGAACTGGGAAGG + Intergenic
1174409781 20:50327383-50327405 AAAGATATTCTGTGCTGGGCTGG - Intergenic
1175117605 20:56694185-56694207 ACTGAGATTCTGGACTTGGAGGG - Intergenic
1175726280 20:61320805-61320827 GCAGAGGTCCTGTGCTGGGAGGG + Intronic
1177298293 21:19205356-19205378 ACAGAAATTCTGGCTTGGGAGGG - Intergenic
1183087203 22:35493730-35493752 ACAGAGTTTCTGAGCTGGAAGGG - Intergenic
950682386 3:14594155-14594177 ACAGAGCACCTGTCCTGGGAGGG - Intergenic
952344842 3:32473717-32473739 ACAGAAATTCTCTACTGACAGGG - Intronic
952807963 3:37375160-37375182 ACAGAGAACCTCTACTAGGATGG - Intergenic
953512715 3:43559023-43559045 AGAAAGATTCTGAATTGGGAAGG + Intronic
955108416 3:55923416-55923438 ATAGAGTTTCAGTTCTGGGATGG + Intronic
958589311 3:96134621-96134643 CCAGGGATTCTGCATTGGGATGG + Intergenic
959871709 3:111336507-111336529 ACAGAAAATCTGAACAGGGAGGG + Intronic
965102344 3:164314491-164314513 ACAGAGATTCTTTACTTTCAAGG - Intergenic
965224747 3:165973500-165973522 AAAGAGATTCTGTACAGCAAAGG + Intergenic
968943928 4:3653786-3653808 ACAGAGTGGCTGTGCTGGGAGGG - Intergenic
970230063 4:13900595-13900617 ACTGAGATTCTACACTGTGAGGG + Intergenic
970959118 4:21852192-21852214 CCAGAGAGTCTGTCCCGGGAAGG + Intronic
973245447 4:48005787-48005809 ACCGAGGCTCTTTACTGGGATGG - Intronic
974238687 4:59214414-59214436 TCTGAGATTCTGTACTTGAAAGG - Intergenic
978895610 4:113884045-113884067 GCAGAGATTCCATGCTGGGATGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980138298 4:128883187-128883209 AGAGAGACCCTGTATTGGGAGGG + Intronic
981441637 4:144790223-144790245 AAAGAGCTTCTGTACAGCGAAGG - Intergenic
983310926 4:166060132-166060154 ACAGAAATTCTGTACTGGGTTGG - Exonic
987060439 5:14238191-14238213 ACAGAGATTTTGTTCTTGGAGGG + Intronic
987761191 5:22164594-22164616 ACAGAGCTCCTGTACGAGGAGGG + Intronic
987850015 5:23339684-23339706 ACAGAGCTTCTGTACAGCAAAGG - Intergenic
988031611 5:25770563-25770585 ACAGAAAATTTGTACTGGGAGGG + Intergenic
988580319 5:32463005-32463027 ACAGGAATTCTGTGCTGGGGTGG + Intergenic
992177554 5:74165256-74165278 ACAGAGATTAAGTGCTGTGAGGG - Intergenic
993426329 5:87769201-87769223 GCAGAGGCTCTGTACTGTGAAGG - Intergenic
993693598 5:91033646-91033668 ACAGAGAATCAGAACTGGGAAGG - Intronic
995379904 5:111520155-111520177 TGACAGATTCTGTACTGAGAGGG - Intergenic
998119345 5:139562643-139562665 ACCGAGACTCTTAACTGGGAAGG + Intronic
998502126 5:142642532-142642554 ACAGGGCTTCTGAACTGGTAGGG + Intronic
998577212 5:143329031-143329053 ACAGAGAATTGGTACTGGCAGGG - Intronic
1001275468 5:170347730-170347752 AAAGAGAATCTGGTCTGGGAAGG - Intergenic
1004865447 6:19848988-19849010 AAATAGCTTCTGCACTGGGAAGG - Intergenic
1007658763 6:43469310-43469332 AGACAGAGTCTGTGCTGGGAAGG + Intergenic
1007872797 6:45060609-45060631 AAAGAGCTTCTGTACTGCAAAGG + Intronic
1008217220 6:48807459-48807481 ACAGAGTTTCAGAGCTGGGAAGG + Intergenic
1008936604 6:56999252-56999274 ATGGAGATTCTGTACAGTGATGG + Intronic
1009659090 6:66586822-66586844 ACAGAGAAAGTGTACTGTGAGGG + Intergenic
1010327992 6:74587567-74587589 CCAGAGATAGTGGACTGGGAGGG + Intergenic
1011095896 6:83661814-83661836 AAACATATTCTGTACTGGAATGG - Intronic
1012803951 6:103870864-103870886 ACAGAGATGCTGTTCTCAGAAGG - Intergenic
1013315477 6:108938258-108938280 ACAGAGATTATGTTTTGGGGTGG - Intronic
1013679877 6:112513359-112513381 ACAGGGATTCATCACTGGGAAGG - Intergenic
1014159685 6:118153752-118153774 AAAGAGATTCAGTACTGTGGTGG - Intronic
1014623383 6:123697027-123697049 TCAGAGATTCTGCAGGGGGAAGG - Intergenic
1015330495 6:131973194-131973216 AGATAGATTCTTTACTAGGAAGG - Intergenic
1015373987 6:132489717-132489739 TCAGATATTCTGTGCTGGGAAGG - Intronic
1016488880 6:144573966-144573988 ACAAGGATACTGAACTGGGATGG + Intronic
1018329492 6:162711950-162711972 TCAGAGATTCTGGTCGGGGAAGG + Intronic
1018805353 6:167254927-167254949 ACACTGAGTCTGTAATGGGAGGG + Intergenic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1022214734 7:28247470-28247492 ACAGAGGTTTAGTAATGGGATGG - Intergenic
1023174064 7:37418563-37418585 AAAGAGCTTCAGTAGTGGGAAGG + Intronic
1024350557 7:48358618-48358640 ACACACATTCTATGCTGGGATGG + Intronic
1032755616 7:134888145-134888167 AAAGAGATTCTGGGCTGGGAAGG - Intronic
1033550347 7:142441346-142441368 CCAGAGTTTCTGCACAGGGAGGG - Intergenic
1034779343 7:153863418-153863440 ACAGAGATTTTGCACTTGGAAGG - Intergenic
1036634819 8:10541700-10541722 GAAGAGCTTCTGTACTGTGAAGG + Intronic
1039064417 8:33596702-33596724 ACAGAGATTCTGCAATTTGAAGG - Intronic
1039385648 8:37133560-37133582 TAAGAGATTCTGTGCTGGAATGG + Intergenic
1039385865 8:37135048-37135070 CAAGAGATTCTGTGCTGGAATGG - Intergenic
1040797972 8:51308003-51308025 TCATAGTTTCTGTAGTGGGATGG - Intergenic
1040864581 8:52035336-52035358 ACAGAAATGCTGCATTGGGATGG + Intergenic
1041378518 8:57226732-57226754 AGAGAGATTATTTACTGAGATGG + Intergenic
1043140505 8:76583002-76583024 ACATAGATTCTCTAATGTGAGGG + Intergenic
1044943669 8:97369859-97369881 AAAGCGATTCTGTTCTGTGATGG - Intergenic
1047500167 8:125434076-125434098 ACAGAGAACCTGGACTGGGATGG - Intronic
1047893299 8:129336914-129336936 ACACAGATTCTGGCCTTGGAAGG - Intergenic
1050731502 9:8714516-8714538 ACAGAGATCCTATAATGGGGAGG - Intronic
1051379154 9:16437202-16437224 ACAGGGTTTATGTACTGGAATGG + Exonic
1051516106 9:17932106-17932128 ACAGAGATCCTCTACTTGGGGGG - Intergenic
1056091137 9:83207228-83207250 ACAGACATCCTGGAATGGGAAGG + Intergenic
1057744850 9:97742733-97742755 AAAGACATTCTGTTCTGGGGAGG - Intergenic
1059533289 9:115057853-115057875 ACAGACATTCTTTACTTTGAAGG + Intronic
1061997562 9:134194202-134194224 TGAGAGAGTCTGTGCTGGGAAGG + Intergenic
1186106141 X:6208642-6208664 ACAGAGCTTTTTAACTGGGATGG + Intronic
1186636063 X:11406252-11406274 ACACAGAGTGGGTACTGGGATGG + Intronic
1186774219 X:12847841-12847863 ACAGAGACTGTGTACTGTGTCGG - Intergenic
1188962477 X:36508912-36508934 ACAGAAAATTGGTACTGGGAGGG - Intergenic
1189523986 X:41800388-41800410 GCAGAGATTCTGCTCAGGGAAGG + Intronic
1190409719 X:50124529-50124551 ACAAAGATACTGTACAGGGGAGG + Intergenic
1190972771 X:55367894-55367916 ACAGAGATTCTCTTCTTGTAGGG + Intergenic
1196416460 X:115476889-115476911 ACAGAGAATCCGTTCTGGTAGGG - Intergenic
1196811639 X:119633666-119633688 ACAGGGATTCTGGAGGGGGATGG + Intronic
1198103376 X:133440737-133440759 ACAGAAATACTGTACGGGGCGGG - Intergenic
1199376307 X:147113902-147113924 AAAGAGACTCTGTACAGGCAAGG + Intergenic
1199420955 X:147644085-147644107 ACAGAAAATTGGTACTGGGAAGG + Intergenic
1199683634 X:150244764-150244786 ACAGACATAAAGTACTGGGAAGG + Intergenic
1199974432 X:152884622-152884644 AAAGAGAGTCTGGGCTGGGAAGG - Intergenic