ID: 931757818

View in Genome Browser
Species Human (GRCh38)
Location 2:65389390-65389412
Sequence GTGTGTTGGGGGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1958
Summary {0: 1, 1: 5, 2: 14, 3: 194, 4: 1744}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931757807_931757818 -6 Left 931757807 2:65389373-65389395 CCTCTTACCCCTGAAGGGTGTGT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG 0: 1
1: 5
2: 14
3: 194
4: 1744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931757818 Original CRISPR GTGTGTTGGGGGAGGAAGGA GGG Intronic
900156269 1:1204495-1204517 GGGTGTGGGGGGAGGGAGGGAGG + Intronic
900490724 1:2947920-2947942 GTGGGGTGGGGGTGGAAGGAGGG - Intergenic
900938583 1:5782760-5782782 GGGTCCGGGGGGAGGAAGGAGGG + Intergenic
900993503 1:6108449-6108471 GGGGGATGGGGGTGGAAGGATGG + Intronic
901258990 1:7857271-7857293 GTGAGTAGGGAGAGGAAGGAGGG - Intergenic
901386176 1:8910766-8910788 GTGTGGTGGGGGATGGAGGGGGG + Intergenic
901689284 1:10962056-10962078 GTGAGGAGGAGGAGGAAGGAAGG - Intronic
901843210 1:11966417-11966439 GGGAGTTGGGGGTGGAGGGATGG + Intronic
901843260 1:11966524-11966546 GGGGGTGGGGGGAGGCAGGATGG + Intronic
901868570 1:12123885-12123907 GTGGATTGGGGGAGCCAGGAGGG + Intronic
902177627 1:14662727-14662749 GTGTGTTGGGGAAGGGAGGGAGG + Intronic
902189587 1:14752811-14752833 GTGTGGTGGTGGAAAAAGGATGG - Intronic
902230312 1:15023416-15023438 GTGGGTAGGAGGGGGAAGGAAGG + Intronic
902373773 1:16020661-16020683 GTGTGTTGTGGGAGGTGGGATGG - Intronic
902378697 1:16042496-16042518 GTGTGTTGTGGGAGGTGGGATGG - Intergenic
902412377 1:16219040-16219062 GAGTGTTGGGGGAAGAACGGGGG - Intergenic
902435765 1:16397366-16397388 TTGTGTCGGGGGAGGCGGGAGGG + Exonic
902592731 1:17486624-17486646 CTGAGTCGGGGGAGGAAGAAAGG - Intergenic
902659122 1:17889236-17889258 ATGTGTTGTGGGAGGGACGAGGG - Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902763304 1:18598491-18598513 GTCTGTTGGGGGAGGCACAAAGG - Intergenic
902916198 1:19641063-19641085 GTGTGGTGGGCAAGGAAGCATGG + Intronic
902991025 1:20186894-20186916 GTGGGTTGGGGGGGGCGGGATGG + Intronic
903171679 1:21558413-21558435 GTGTTTTGAGGAAGGCAGGAGGG + Intronic
903333533 1:22609792-22609814 GTGTGCTGGGGCTGGGAGGAGGG + Intergenic
903339274 1:22643891-22643913 GGCTCCTGGGGGAGGAAGGAAGG + Intronic
903552276 1:24166209-24166231 GGGTGGTTGGGAAGGAAGGAAGG - Intronic
903972677 1:27129325-27129347 GTGTGGTGGGAGAGGAGGCAGGG - Intronic
903992352 1:27282311-27282333 GGGTGCTGGGGAAGGAAGTAAGG + Intronic
904010170 1:27384761-27384783 GGGTTCTGGGGGAGGGAGGAGGG + Intergenic
904117820 1:28175441-28175463 GTGTGTTGGGGGAGGCGGTAGGG - Intronic
904205337 1:28851056-28851078 GAGAGATGGGGAAGGAAGGAAGG + Intronic
904396180 1:30224057-30224079 GGGTGTAGGGGGAGGGAGGGGGG + Intergenic
904613320 1:31736862-31736884 GTGTGTGGGTGCAGGAAGGCGGG - Intronic
904876847 1:33661928-33661950 GTGTGTGGTGGGAGGGAGGGGGG - Intronic
904920345 1:34003125-34003147 GGGAGTTGGAGAAGGAAGGAGGG - Intronic
904952679 1:34256607-34256629 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
905014508 1:34768078-34768100 GTGTGGTGGGTGAGGAGGGTGGG - Intronic
905040983 1:34958077-34958099 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
905096054 1:35471907-35471929 TTGTTTTGGAGGAGGAAGGAAGG - Intronic
905171861 1:36114438-36114460 GTGTGTTGGGGGAGGAGCCCAGG - Intronic
905461433 1:38125373-38125395 GGGTGTTGGGGAGGGAAGGTGGG + Intergenic
905603132 1:39271064-39271086 TTGTGTTATGGTAGGAAGGAAGG + Intronic
905832657 1:41084976-41084998 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
905853186 1:41289417-41289439 CTGGGTTGGGGAAGGAAAGAAGG + Intergenic
905940135 1:41856649-41856671 ATGTCTTGAGGGAGGAAGGGAGG + Intronic
906155912 1:43613793-43613815 CTGTGGTGGGTGAGGAAGCAGGG + Intronic
906322970 1:44828035-44828057 GTGGGCTTGGGGAGGCAGGATGG + Exonic
906333920 1:44911848-44911870 GTGGGTTGGGGGAGGGGGGAGGG - Intronic
907190153 1:52641473-52641495 GAGTGTTGTGGGAGGAAAAAAGG + Intronic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907520393 1:55019887-55019909 GCATGGAGGGGGAGGAAGGACGG - Intergenic
907718620 1:56951025-56951047 GTGTGTTGGGGAGGAAGGGAAGG + Intronic
907740348 1:57159644-57159666 GTGTGTTGGGGGTGGCAGGGTGG - Intronic
907853713 1:58281041-58281063 GTGTGTTTGGGGAGAAAGACAGG + Intronic
908077185 1:60533219-60533241 GGGTGTTGGGAGAGAAAGGGTGG + Intergenic
908213978 1:61932164-61932186 GTGTGTTGGGGGGGCAGGCAGGG - Intronic
908219451 1:61989659-61989681 GTGGGTTGGGGCAGATAGGAAGG + Intronic
908427494 1:64021686-64021708 GTGTGTATAGGGAGGAAAGAAGG + Intronic
908510568 1:64847295-64847317 GGGGGTTGGGGGTGGAAGGGAGG + Intronic
908630745 1:66104079-66104101 GAGGGTGGGGGGAGGGAGGAGGG - Intronic
908678004 1:66627889-66627911 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
908689874 1:66766985-66767007 GAGGGTTGAGGGTGGAAGGAGGG + Intronic
909073476 1:71025049-71025071 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
909170438 1:72286489-72286511 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
909175042 1:72346736-72346758 GTGGGTAGGGGAAGGTAGGAAGG + Intergenic
909217227 1:72904929-72904951 GTGAGGTGGGGGAGGGGGGAGGG + Intergenic
909310982 1:74148578-74148600 GTGTTGTGGGGGAAGAAGCATGG + Intronic
909449637 1:75784277-75784299 TGGTGTTGGGGGAGGGGGGAAGG + Intronic
909455024 1:75840518-75840540 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
910250074 1:85187865-85187887 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
910266407 1:85342408-85342430 GTGTGTTGGAGGAGGAGGTATGG + Intronic
910266914 1:85347615-85347637 GTGGGATGGGGGAGGGTGGAGGG + Intronic
910314278 1:85864392-85864414 GTGGGATGGGGGAGGGGGGAGGG + Intronic
910737671 1:90479459-90479481 GTGGATTGGAGGGGGAAGGAAGG - Intergenic
911112998 1:94211895-94211917 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
911470019 1:98306875-98306897 GTGTGTTGGGCAGGGAAGGATGG + Intergenic
911493689 1:98602476-98602498 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
911568285 1:99491139-99491161 GTGTGTTGGGAGAGGAAGGAGGG - Intergenic
912001360 1:104838700-104838722 GTTTGTTGGGGGAGAAAAGGAGG - Intergenic
912170802 1:107097180-107097202 GAGGGTTGGGGGAGGGAGCAGGG - Intergenic
912874778 1:113346651-113346673 ATGGGGTGGGGGAGGAGGGAAGG + Intergenic
912945521 1:114081041-114081063 GTGTGCTGGGAGAGGGTGGAGGG + Intergenic
913129516 1:115827243-115827265 GGGGGTTGGGGGAGGCCGGAGGG - Intergenic
913233627 1:116762334-116762356 GTGTATTAGGGATGGAAGGAGGG + Intronic
913235483 1:116777496-116777518 GTGTGTTGGCGGAGATAGGGGGG + Intergenic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913433537 1:118822891-118822913 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
913457658 1:119049861-119049883 GTGTTCTGGGGGAGGATTGATGG - Intronic
913588475 1:120299683-120299705 ATGTGTTGGGGGGTGAAGGAGGG - Intergenic
913619710 1:120598686-120598708 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914570493 1:148911555-148911577 ATGTGTTGGGGGGTGAAGGAGGG - Intronic
914602337 1:149218714-149218736 ATGTGTTGGGGGGTGAAGGAGGG + Intergenic
914815437 1:151059240-151059262 GAATGTTGGGGGAGGTGGGAGGG - Exonic
915048241 1:153038586-153038608 GTGTGTAGGGGAGGGAGGGAAGG - Intergenic
915054189 1:153110585-153110607 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
915107021 1:153541080-153541102 TTGTGGTGGGAGAGGAATGATGG - Intronic
915213198 1:154324981-154325003 GCGTGGTGGGGGCGGAGGGAAGG + Exonic
915489419 1:156242967-156242989 ATGTGTAGGGAGAGGAGGGATGG + Intronic
915506006 1:156356960-156356982 GTGAGCTGGGGGAGGGAGCAGGG - Intronic
915532674 1:156512138-156512160 GGGGGTGGGGGGTGGAAGGAGGG + Intergenic
915642747 1:157241909-157241931 TTGGGTAGGGGGAGGAAGGAGGG - Intergenic
915678793 1:157559292-157559314 TTGGGTGGGGGGAGGAGGGAGGG - Intergenic
915780564 1:158545327-158545349 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
915782446 1:158567643-158567665 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916001720 1:160623031-160623053 GTGTGTTGGGGAAGGTAGTGGGG + Intronic
916052004 1:161042768-161042790 GTCTGGTGGGGAAGGAAGGGAGG + Intronic
916122299 1:161539301-161539323 GTGGGTGGGGGAAGGAGGGAGGG + Intergenic
916499523 1:165375049-165375071 GTGTTTTGGGGAAAGAAGCAAGG + Intergenic
916512720 1:165487071-165487093 GTATAGTGGGGGAGGAACGAGGG - Intergenic
916631361 1:166617922-166617944 GTGTGTTGGTGGGGGAAGGGTGG + Intergenic
916909875 1:169335551-169335573 GTGGGGTGGGGGATGAGGGAAGG + Intronic
916937104 1:169640506-169640528 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
917232953 1:172857596-172857618 GTGTGTTGGGGGTGGCAGGATGG - Intergenic
917253338 1:173087182-173087204 ATATGATGGGGGATGAAGGAGGG - Intergenic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
917539797 1:175901511-175901533 GGGTGTTAGGGGAGGTAGGGAGG + Intergenic
917609190 1:176669011-176669033 GTGGGTTGAGGGAGGATGGGAGG + Intronic
917979392 1:180259762-180259784 GTCTGCTGGGTAAGGAAGGAGGG + Intronic
918133144 1:181646504-181646526 GTGTGTTGGGGCTGGGAGTAAGG - Intronic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
918898883 1:190386080-190386102 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
919002639 1:191853386-191853408 ATGGGTTGGGGGAGGGGGGAGGG - Intergenic
919130533 1:193445120-193445142 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
919177453 1:194036331-194036353 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
919322662 1:196062594-196062616 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
919357874 1:196549004-196549026 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
919510304 1:198454644-198454666 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
919524205 1:198626988-198627010 GTGTGCTGGGGCAGGAAAGCAGG + Intergenic
919923853 1:202182061-202182083 GTGTGGTGGCTGAGGAAGAATGG - Intergenic
920005023 1:202826879-202826901 GTTTGTTGGGGAGGAAAGGAGGG - Exonic
920154533 1:203937646-203937668 GAGGGGAGGGGGAGGAAGGAAGG + Intergenic
920191201 1:204194985-204195007 GGGTGGTGGGCCAGGAAGGAGGG + Intronic
920210718 1:204326300-204326322 GTGTGTTGGCACAGGCAGGAGGG - Intronic
920277856 1:204821095-204821117 TTGTGTTGGGGGTGGAGGCAGGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920400342 1:205672220-205672242 GTGTGGTGGGGGAGGCACGTGGG - Intronic
920455354 1:206097060-206097082 GTGTCTTGGGCCAGGTAGGATGG - Intronic
920551999 1:206869799-206869821 GTGAGGTGGGGGAAGAAGGAAGG - Intergenic
920552577 1:206875834-206875856 GTTTTTTGGGGGAGGGGGGAGGG - Intergenic
920685318 1:208104721-208104743 GTGTGATGATGTAGGAAGGATGG - Intronic
920732775 1:208503400-208503422 GGGAGTTGGTGGGGGAAGGAAGG + Intergenic
920992208 1:210950360-210950382 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
921412239 1:214848096-214848118 GTGTGATGGGTGGGGGAGGAGGG - Intergenic
922032868 1:221820760-221820782 GTTAGTTGGGGGAGGGAGGAAGG - Intergenic
922086726 1:222355748-222355770 TTGGGTTGGGGGAGGGGGGAGGG + Intergenic
922110161 1:222548241-222548263 ATGGGTTGGGGGAGGGGGGAAGG - Intergenic
922124632 1:222711077-222711099 GTGTGTCGGGGGCGGATGGGGGG + Intronic
922206949 1:223456355-223456377 GTGTGGTGGGGGTGGATGGGTGG - Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923051784 1:230395107-230395129 GAGTGTGAGGGGAGGAGGGAGGG - Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923657661 1:235932258-235932280 GTGTGGTGGGGAATGAGGGAAGG - Intergenic
923681384 1:236121522-236121544 TTGGGTTAGGGGAGGAAAGAAGG - Intergenic
923724301 1:236493238-236493260 GTGAGGTGGGAGAGGAGGGAAGG - Intergenic
923855298 1:237839183-237839205 GTGTGCTGGCGGGGCAAGGATGG - Intergenic
923874956 1:238037253-238037275 GTGCGTCGGGGGAGGGGGGAGGG - Intergenic
924034125 1:239918831-239918853 GTGGATTGGTGGAGTAAGGAGGG - Intergenic
924085497 1:240447255-240447277 GTGTGTTGGGGGATGTTGGGAGG + Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063528204 10:6804288-6804310 GTGGGGTAGGGGAGGGAGGAGGG - Intergenic
1063551467 10:7037796-7037818 GTGGGATGGGGGAGGGGGGAGGG + Intergenic
1063567408 10:7182716-7182738 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1063898680 10:10709418-10709440 GTGGGCGTGGGGAGGAAGGAGGG - Intergenic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064037510 10:11926575-11926597 GTCTGTTGGGAGAACAAGGAGGG + Intronic
1064213541 10:13380970-13380992 GTGTGGTGGGGGCAGAAGGCAGG + Intergenic
1064375874 10:14795210-14795232 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1064499546 10:15954737-15954759 TGGTGTTGGGGGAAGTAGGATGG + Intergenic
1064794722 10:18998433-18998455 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1064906151 10:20348025-20348047 GTGTGGTGGGGGAGGGGGCAGGG - Intergenic
1065024133 10:21525753-21525775 GTGTGTTGGCGGTGGAAGGTGGG + Intergenic
1065391772 10:25189636-25189658 TGGGGTTGGGGGAGGAGGGAGGG + Intronic
1065446032 10:25800529-25800551 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1065464910 10:26009227-26009249 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1065487700 10:26250494-26250516 GTGGGATGAGGGAAGAAGGAGGG + Intronic
1066021581 10:31309211-31309233 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1066080517 10:31927496-31927518 GGGAGGTGGTGGAGGAAGGAAGG - Intronic
1066159074 10:32709320-32709342 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1066578809 10:36857182-36857204 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067172867 10:43922293-43922315 CCGTGTTTGGGGAGGAAGGGAGG - Intergenic
1067270614 10:44788435-44788457 GTGTGTGGCGTGAGGTAGGAAGG - Intergenic
1067300689 10:45006060-45006082 GTGTGTGGAAGGAGGAAAGAGGG + Intergenic
1067833697 10:49624896-49624918 GTGGGTGGTGGGTGGAAGGAGGG + Intronic
1067947268 10:50697444-50697466 GTGTGTTGGAGGAGGATGTGGGG + Intergenic
1068010541 10:51444315-51444337 GTGTGTTGGAGGTGGAGGAATGG + Intronic
1068018154 10:51544194-51544216 GGGTGGTGGGGGAGGGGGGAGGG - Intronic
1068332586 10:55590312-55590334 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068688250 10:59890872-59890894 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
1069055077 10:63836380-63836402 GTGTGGCGGGGGAGAAAGAAAGG + Intergenic
1069081301 10:64090834-64090856 ATGTCTTGGTGGAGGTAGGAAGG + Intergenic
1069410258 10:68146191-68146213 CTGAGGTGGGGAAGGAAGGAGGG - Intronic
1070113279 10:73505247-73505269 GTGTGTTGGGGAAGGAATTATGG - Intronic
1070542786 10:77428711-77428733 GTGTGATTGGGGAAGAAAGAGGG + Intronic
1070809068 10:79288497-79288519 GTGTGTTGGGGGAGGGAAATTGG - Intronic
1070822953 10:79373484-79373506 ATGTGCTGGGGAAGGAAGGCGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070882582 10:79862432-79862454 GTGTGTTGGAGGAGGATGTGGGG + Intergenic
1070925816 10:80220852-80220874 CTATGGTGGGGGAGGAAGGAGGG - Intergenic
1070952853 10:80444759-80444781 GTGTGTTGGGGGAGGAAGGGAGG - Intergenic
1071044075 10:81352072-81352094 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1071480032 10:86058168-86058190 GAGGGCTGGGGGAGGAAGGGGGG - Intronic
1071496498 10:86170932-86170954 ATGAGTTGGGGGAGGAAGCGTGG - Intronic
1071649148 10:87378731-87378753 GTGTGTTGGAGGAGGATGTGGGG + Intergenic
1071829340 10:89356214-89356236 GTGAGTAGGGGGAGGAAGGGTGG + Intronic
1071929105 10:90445984-90446006 GTGGGTGGGGGGTGGGAGGAGGG - Intergenic
1071971886 10:90916037-90916059 GAGGGGTGGGGGAGGAGGGAAGG + Intronic
1072007001 10:91260809-91260831 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1072008165 10:91276840-91276862 GTGGGTTGGGTGAGGTAGAATGG + Intronic
1072038938 10:91589775-91589797 GTGTGGGGGAGAAGGAAGGAGGG + Intergenic
1072058570 10:91786496-91786518 GGGAGTTGGGGGAGGAGAGAGGG - Intergenic
1072203775 10:93184116-93184138 GAGGGTTGGGGGTGGGAGGAAGG - Intergenic
1072399733 10:95085080-95085102 GTGGGGTGGGGGAGGAGGGAGGG + Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072408077 10:95173393-95173415 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
1072635687 10:97176428-97176450 GTCTCTTGGGGAGGGAAGGAGGG - Intronic
1072740427 10:97905863-97905885 GGGTGCTGGGGGAGGAGAGAGGG + Intronic
1072910212 10:99494122-99494144 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
1073093780 10:100967870-100967892 TTGTGTTGGGGAACTAAGGAAGG - Intergenic
1073128440 10:101168094-101168116 GCTTGTTGGGGGTGGGAGGAGGG + Intergenic
1073269182 10:102247288-102247310 GTGTGTTGGGAGAAGGGGGATGG + Intronic
1073300820 10:102470150-102470172 GTGTTTGGGGTGGGGAAGGAAGG + Intronic
1073332834 10:102681925-102681947 GTCTGTGGGTGGAGGAGGGATGG + Intronic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1073641338 10:105255322-105255344 TGGTGTCGGGGGAGGAGGGAGGG + Intronic
1073645323 10:105295720-105295742 GCCTGTTGGGGGTGGAGGGAAGG - Intergenic
1073663955 10:105509132-105509154 GTGTGTTAGGGGAAAAAGAAGGG + Intergenic
1073723457 10:106202359-106202381 ATGTGTTGTGGGAGGAACCAAGG + Intergenic
1073777082 10:106798429-106798451 GTGGGTGGGGGGAGGGAGGAAGG - Intronic
1074119296 10:110481529-110481551 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074394857 10:113089298-113089320 GTGGGTTAGGGCAGAAAGGAAGG + Intronic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074575980 10:114669798-114669820 GTGTGTTGTGGCGGGAGGGAAGG + Intronic
1074657457 10:115609695-115609717 GTGTGTTGTGGGAGGAAGCAGGG + Intronic
1074881708 10:117664832-117664854 GTGTGCCAGGGGAGGAGGGATGG - Intergenic
1074902718 10:117833027-117833049 GTGGGGAGGGGGAGGGAGGAGGG - Intergenic
1074955088 10:118380832-118380854 GAGAGATGGGGTAGGAAGGATGG - Intergenic
1075015642 10:118908441-118908463 GGGGGCTGGGGGAGGGAGGAAGG - Intergenic
1075054549 10:119207662-119207684 GCGTGTTGAGGGAGGGGGGAGGG + Exonic
1075136415 10:119789913-119789935 GTGTGTTGTAGGATGAGGGAGGG + Intronic
1075170550 10:120109729-120109751 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1075242749 10:120793137-120793159 GTGTGTTGTGTGAGGGAGGGGGG - Intergenic
1075875066 10:125799405-125799427 GTGTGTTGGGGAATGCAGGGTGG + Intronic
1075970846 10:126650875-126650897 GTGGCTGGGGGGTGGAAGGAAGG - Intronic
1076311994 10:129515093-129515115 GTGGCTGGGGGCAGGAAGGAGGG + Intronic
1076490640 10:130859128-130859150 GTGCATTGGAGGAGGAAGGAAGG + Intergenic
1076602053 10:131663621-131663643 GTGGGAAGGGGTAGGAAGGAAGG - Intergenic
1076916418 10:133424802-133424824 GTGTGGAGGGGCAGGAAGCACGG - Intergenic
1076936523 10:133569597-133569619 GTGTGGAGGGGCAGGAAGCACGG - Intronic
1077162123 11:1118581-1118603 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1077388241 11:2285827-2285849 GTGTGTTGGGGGAGGAACCAGGG + Intergenic
1077396200 11:2323833-2323855 TTGGGTTGGGGGTGGGAGGAGGG + Intergenic
1077430527 11:2513830-2513852 GTGGGCTGGGAGAGGGAGGAAGG + Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1078126178 11:8565828-8565850 GATTGTTGGTGGAGGAACGAGGG - Intronic
1078160673 11:8837236-8837258 GTGTATTTGGGGAGGAGGGATGG + Intronic
1078579392 11:12526854-12526876 TCTTGTTGGGGGAGGGAGGAAGG + Intronic
1078713793 11:13820150-13820172 TGGGGTGGGGGGAGGAAGGAGGG - Intergenic
1078718923 11:13865712-13865734 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1078770127 11:14341879-14341901 TGGTGTTGGGGGAGGAGAGAGGG - Intronic
1078809850 11:14747691-14747713 GTGTATTGGGGGAGGGAAGGAGG + Intronic
1078952266 11:16147351-16147373 GTGGGGTGGGGGAGGAGGGAAGG + Intronic
1079246781 11:18758135-18758157 ATGTGCTGGTGGATGAAGGATGG + Intronic
1079333637 11:19552887-19552909 GTGTGTGTGGGGGGGAAGGGGGG + Intronic
1079592149 11:22193515-22193537 AAGTGTTGGCGGAGGAAGGTAGG + Exonic
1079657484 11:23000930-23000952 GTGGGTAGGTGGAGGAATGACGG - Intergenic
1079765511 11:24387564-24387586 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1079803677 11:24902305-24902327 GAGTGTTGAGGGTGGGAGGAGGG - Intronic
1079862629 11:25693117-25693139 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080410625 11:32021531-32021553 GTGGGATGGGGGAGGGGGGAGGG + Intronic
1080574957 11:33589760-33589782 GTGGGGTGGGGGAGGTGGGAGGG + Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081326902 11:41756201-41756223 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1081408478 11:42726300-42726322 GTGTGCTGGTGAAGGAAGGGAGG - Intergenic
1081662407 11:44896118-44896140 GTGGATTGAGGGAGGAAGGGAGG + Intronic
1081662563 11:44896920-44896942 GTGGGTTGAGGGAGGAAGGGAGG + Intronic
1082118389 11:48351978-48352000 GGGGGTGGGGGGAGGGAGGAGGG + Intergenic
1082246295 11:49927185-49927207 GTGGGATGGGGGAGGGGGGAGGG - Intergenic
1082559589 11:54602851-54602873 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1082566804 11:54690487-54690509 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1082627202 11:55500436-55500458 GTGGGTTGGGGTAGGGCGGAGGG + Intergenic
1082743532 11:56937800-56937822 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1082790828 11:57345859-57345881 GGGGGCTGGGGGAGGAGGGAGGG - Intronic
1082792032 11:57352771-57352793 GGGTATTTGGGGAGGCAGGACGG + Intronic
1082956075 11:58871425-58871447 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1082978559 11:59099371-59099393 GTGTGTTGGGTGGGGCAGGTGGG - Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083069742 11:59965140-59965162 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1083215377 11:61215496-61215518 TTGAGATGGGGGAGGAAGGAAGG - Intergenic
1083218261 11:61234325-61234347 TTGAGATGGGGGAGGAAGGAAGG - Intergenic
1083412815 11:62505726-62505748 GTGTGTCGGGGGAGGCAGCAGGG - Intronic
1083511440 11:63212666-63212688 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1083605004 11:63973269-63973291 GAGTGATAGGGTAGGAAGGAAGG + Intergenic
1083610987 11:64004201-64004223 GGATGTTGTGGAAGGAAGGAGGG + Intronic
1083725227 11:64624371-64624393 GGGTGCTGGAGGAAGAAGGAAGG - Intronic
1083891185 11:65596514-65596536 GTGTGGTGGGAGAGGAATGGTGG + Intronic
1083992251 11:66253781-66253803 GTGTGCTGGTGGGGGAAGGCTGG - Intergenic
1083994448 11:66265292-66265314 GTGTGTTGGGGGTGAGAGTATGG - Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084333982 11:68446363-68446385 GAGGGGTGTGGGAGGAAGGAAGG + Intronic
1084421417 11:69062511-69062533 GTGTGCTGGGCAAGGCAGGAGGG + Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084447438 11:69212097-69212119 TTGGGTTGGGGGACGGAGGAGGG - Intergenic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1084609907 11:70195381-70195403 GAGTGTTGGTGGAGGAGGTAAGG + Intergenic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084956462 11:72694132-72694154 GTGGATTGGGAGAGGGAGGAGGG - Intronic
1084992999 11:72946395-72946417 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1085161289 11:74348696-74348718 TTGGGTTGGGGAAGGAAGGGAGG - Intronic
1085236292 11:75018054-75018076 GTGGGTGGGGAGAGAAAGGAAGG - Intronic
1085278292 11:75314045-75314067 GTGTGTGGGGGCAGGGAGCATGG - Intronic
1085287396 11:75372592-75372614 TTTTGTTGGGGGAGGAAAGGCGG + Intergenic
1085370436 11:75998958-75998980 GTGTGGTGGAGCAAGAAGGAGGG + Intronic
1085417331 11:76328091-76328113 GGGTGTGGGTGGAGGAGGGAAGG + Intergenic
1085472033 11:76764617-76764639 GTGGGTGGGGGCAGGAAGGAGGG - Intergenic
1085607048 11:77910442-77910464 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1086188680 11:84051623-84051645 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1086264326 11:84979655-84979677 GTGGGGTGGGGGAGGGCGGAGGG + Intronic
1086308701 11:85511221-85511243 GTGGGGTGGGGGAAGAGGGAAGG + Intronic
1086393551 11:86390692-86390714 GTGGGTAGGAAGAGGAAGGAAGG + Intronic
1086567804 11:88246458-88246480 GTGGGATGGGGGAGGGGGGAAGG + Intergenic
1086570095 11:88273164-88273186 GTGTGTGGGGGTAGGAAAGTGGG + Intergenic
1086628973 11:88992866-88992888 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1086947621 11:92858804-92858826 GGGGGTTGGGGGAGGAATGAAGG + Intronic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087340760 11:96903971-96903993 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1087452426 11:98342265-98342287 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1087564444 11:99836284-99836306 GGGGGTTGGGGGAGGGGGGAGGG - Intronic
1087607194 11:100391072-100391094 GAGGGTTGGGGGTGGGAGGAGGG + Intergenic
1087611594 11:100440925-100440947 GTGTGTTTGAGGAAGAATGAAGG + Intergenic
1088078707 11:105883418-105883440 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1088168687 11:106969506-106969528 AAGGGTTGGGGGAGAAAGGAAGG + Intronic
1088369954 11:109078221-109078243 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088616543 11:111635417-111635439 GAGGGAGGGGGGAGGAAGGAAGG + Intronic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1088780972 11:113133654-113133676 GTGTGATGGGGGAGGAAGTCAGG + Intronic
1088919483 11:114250936-114250958 GGGTCTTGGTGGAGGAAGGCCGG - Intergenic
1088950867 11:114568546-114568568 GGTAGTTGAGGGAGGAAGGAAGG - Intergenic
1089008844 11:115115838-115115860 GAGGGTGGGGGAAGGAAGGATGG + Intergenic
1089190108 11:116647587-116647609 GTGAGTTGAAGAAGGAAGGAAGG + Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089315677 11:117589407-117589429 TTGAGTTGGGGGAGGTGGGAGGG - Intronic
1089366289 11:117922981-117923003 ACGTGTTGGGGCAGGAAGGCAGG + Intronic
1089479274 11:118791745-118791767 GAGTGTGGGGGCAGGAAGGGGGG + Intergenic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089673876 11:120075962-120075984 GTGTGTTGGGGTGGGGAGGAGGG + Intergenic
1089733726 11:120535364-120535386 GTGTGAAGGGGGAGGTAAGAGGG + Intronic
1089923824 11:122236441-122236463 GAGTGTGGAGGGTGGAAGGATGG - Intergenic
1089934556 11:122350376-122350398 GCTTCTTGGGGGCGGAAGGATGG + Intergenic
1089958244 11:122592604-122592626 GACTCTTGGGGAAGGAAGGATGG + Intergenic
1089976097 11:122732679-122732701 GGTTGTTGGGGGTGGAAAGATGG - Intronic
1090062784 11:123478114-123478136 GACTGTGGTGGGAGGAAGGAAGG - Intergenic
1090184445 11:124727348-124727370 TTATGGTGGTGGAGGAAGGAAGG - Intergenic
1090213349 11:124938674-124938696 GGGGGTTGGGGGAGCAAGCAAGG + Intergenic
1090259980 11:125312543-125312565 GTGTGTTGAGGCAGGAGGGCCGG + Intronic
1090401636 11:126453053-126453075 GTGAGTTGGGGGAGGTGGGTGGG - Intronic
1090406484 11:126478833-126478855 GTGAGTAGTGGGAGGGAGGAGGG + Intronic
1090510430 11:127369025-127369047 GTGGGGTGGGGGAGGCGGGAGGG + Intergenic
1090863493 11:130674861-130674883 GTGATTTGGGGATGGAAGGATGG + Intronic
1091131612 11:133151414-133151436 GGAAGATGGGGGAGGAAGGAAGG + Intronic
1091223970 11:133946755-133946777 GTGGGGTGGAGGAGGAAGGCTGG - Intronic
1091354079 11:134922257-134922279 AGGTGCTGGGGGAGGAAGAAGGG + Intergenic
1091439152 12:499094-499116 GAGTTTTGGGGGAGGATAGAGGG + Intronic
1091518957 12:1216595-1216617 GTGGGGTCGGGGAGGAGGGATGG + Intronic
1091761711 12:3091860-3091882 CTGTGTTGGAGGAGGGAGTATGG + Intronic
1091915973 12:4272175-4272197 GGGTGGTGGGGGGGAAAGGAGGG - Intergenic
1091936686 12:4440442-4440464 GTGTGTTGGATGGAGAAGGATGG + Intronic
1092272835 12:7037164-7037186 GTGTGTTGGCGGGGGAGGGAGGG + Intronic
1092394371 12:8112366-8112388 AAATGTTGGGGGAGGGAGGAAGG - Intergenic
1092491139 12:8946420-8946442 GTGTGTTGGGGAGGGCAGGTAGG + Intronic
1092713159 12:11358881-11358903 GTGGGGTGGGGGAGCAGGGAGGG + Intronic
1092751089 12:11719816-11719838 GTGTGAGGGAAGAGGAAGGAAGG - Intronic
1092783884 12:12010727-12010749 GTGTGTTTAGGGAAGATGGATGG - Intergenic
1093141088 12:15511278-15511300 GTGTGTTGGAGGAGGAAAAGTGG - Intronic
1093212032 12:16319370-16319392 GTGTGTTGTTGGGGGAAGCAGGG + Intergenic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093989674 12:25575829-25575851 TGGTGTTGGGGGAGGAGGGAGGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094151956 12:27294610-27294632 TTGGGATGGGAGAGGAAGGATGG - Intronic
1094406301 12:30119958-30119980 GGGTGTTGGGGGAGGAGGTGGGG - Intergenic
1094730270 12:33166656-33166678 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1094741206 12:33291135-33291157 TTTTGTTGGGGGAAGAAGGCAGG + Intergenic
1095074381 12:37898382-37898404 GTGGGTTGGGGGAGGGGGTAGGG + Intergenic
1095085791 12:38056516-38056538 GGGTGTGGGGTGAGGACGGAGGG - Intergenic
1095208229 12:39462730-39462752 GTATTTTGGGGGACCAAGGATGG + Intergenic
1095339150 12:41067616-41067638 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1095417381 12:41991404-41991426 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1095912257 12:47440201-47440223 GTGTGTTGCTGGCAGAAGGACGG + Intergenic
1096122839 12:49099500-49099522 GTATTTAGGGGGAGGTAGGAGGG + Intronic
1096230214 12:49892611-49892633 GAGTGGTGAGGGAGGTAGGAGGG - Intronic
1096432597 12:51559728-51559750 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1096548579 12:52357433-52357455 GGGGGTTGGGGGAGGCAGGAAGG + Intergenic
1096843914 12:54395038-54395060 GTCTGATGGGGGATGAGGGAGGG + Intergenic
1096876696 12:54635113-54635135 GTGTGGTGGGGAAGGGAGGAGGG - Intergenic
1097017059 12:55994610-55994632 TTATGTTGGGAGAGGAAGAAAGG - Exonic
1097022309 12:56029011-56029033 TGGTGGTGTGGGAGGAAGGAGGG - Intronic
1097472804 12:60016764-60016786 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1097580350 12:61447912-61447934 GTGGGTTGGGGGACGGGGGAGGG + Intergenic
1097588102 12:61539687-61539709 GGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1097749503 12:63336607-63336629 GGGAGTTGGGGGATGAAGGAAGG + Intergenic
1097778820 12:63680117-63680139 GTGTGCTGGGGGTGGGGGGAAGG - Intergenic
1097972903 12:65653639-65653661 GTGTGTTGGAAGAGGGAGTATGG - Intergenic
1098063139 12:66584257-66584279 GTGGGGTGGGGGAGGTGGGAGGG + Intronic
1098143069 12:67470158-67470180 GTGGGTTGGGGGGGCAATGATGG + Intergenic
1098177281 12:67805957-67805979 GGGTGGTGGGGAAGGAGGGAGGG - Intergenic
1098420856 12:70296128-70296150 GTGTGTTGGTGGGGGAGGGGAGG - Intronic
1098579778 12:72085627-72085649 GTGTGTGGTGGGGGGAAGAATGG + Intronic
1098819266 12:75208369-75208391 GTGTGTTTGGGGAGGCAGAGAGG - Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099195872 12:79615280-79615302 GGGTTTTGGGGGAGAAAGAAAGG - Intronic
1099207807 12:79748215-79748237 ATCTGTTGGGTGAGGGAGGATGG - Intergenic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1099440283 12:82690165-82690187 GTGTGAAGGGGGAGGAAAGCTGG + Intronic
1099491133 12:83289742-83289764 GTTTGTTGAGTGAAGAAGGAAGG + Intergenic
1099935433 12:89119356-89119378 GTTTGTTGGGGGACGGGGGAAGG - Intergenic
1099941605 12:89195633-89195655 GTGTTGTGGGGGAGGAGGAAGGG - Intergenic
1100196645 12:92253861-92253883 GAGTGTGGGGGGCGGGAGGAGGG - Intergenic
1100219829 12:92492981-92493003 CTGTGTTGGGGTTGGGAGGAGGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100578715 12:95918300-95918322 GTGTGCTGGGGAAGGAAGAAGGG - Intronic
1100661149 12:96700272-96700294 GTGTCATGGGGGAGGGAGCATGG + Intronic
1100668878 12:96787668-96787690 GTTAGTTGGTGGAGAAAGGATGG + Intronic
1101135744 12:101741165-101741187 GTGTATTGGGTAAGGAATGACGG + Intronic
1101315524 12:103625501-103625523 GTGGGTGGGGGGAAGGAGGAGGG - Intronic
1101432383 12:104637336-104637358 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1101492494 12:105222448-105222470 GTGTGGTGAGTGAGGAAGGCGGG + Intronic
1101541583 12:105670435-105670457 GTGAGTTGAGTGAGGAAGGATGG + Intergenic
1101583432 12:106064494-106064516 GTGTTTGGGGGGAGGAAGAAGGG + Exonic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1101840722 12:108325742-108325764 GTGTGTTTAGAGAGGCAGGATGG - Intronic
1102233413 12:111279043-111279065 GTGCGCTGGGGGAGGAAACAAGG + Intronic
1102309010 12:111829302-111829324 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1102382896 12:112482778-112482800 GGCTTTTGGAGGAGGAAGGAGGG + Intronic
1102394210 12:112574079-112574101 ATGGGTTGGTGGAGGAGGGAGGG + Intronic
1102419713 12:112794091-112794113 ATGTGATGGGGGAGGAGGGAGGG - Intronic
1102531087 12:113547188-113547210 GGGTGTGGGGGGAGGAAGAGGGG + Intergenic
1102772072 12:115486761-115486783 GGGGGTTGGAGGAGGAGGGAGGG - Intergenic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1103139021 12:118532867-118532889 CTGAGTTGGGGGAGAAAGGGAGG - Intergenic
1103443528 12:120979966-120979988 GTGTGGGGGAGAAGGAAGGATGG + Intronic
1103617222 12:122161990-122162012 GTCTGTTGGGGGAACACGGATGG - Intergenic
1103661462 12:122522566-122522588 GTGGGGTGGGGGAGGAATAAGGG + Intronic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104182891 12:126399476-126399498 GTGTGGTGGGTGAGGGATGAGGG - Intergenic
1104281641 12:127383346-127383368 GTGTGTTGGGGGGCGGAGGGGGG - Intergenic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104752147 12:131246475-131246497 GAGGGTTGGGTCAGGAAGGAGGG - Intergenic
1104779818 12:131412928-131412950 GTGTGTTGGGGGCAGGATGAGGG + Intergenic
1104849923 12:131867967-131867989 GTGTGGTGGGCATGGAAGGATGG + Intergenic
1104859608 12:131917393-131917415 GGGTGCTGGGAGAGCAAGGAAGG - Exonic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105413064 13:20187283-20187305 GTTTGGTGGGGAAGGAAGGGAGG - Intergenic
1106468153 13:30031183-30031205 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1106590123 13:31091622-31091644 GGGTGTGGGAGGAGGAGGGAAGG - Intergenic
1106904071 13:34386590-34386612 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1107269483 13:38598408-38598430 GTCTGTGGAAGGAGGAAGGAAGG + Intergenic
1107617533 13:42185980-42186002 GTCTGTTGGGGGAGGAGTGGTGG + Intronic
1107634309 13:42377011-42377033 GGGGGTGGGGGGAGGAAGGAAGG - Intergenic
1107985011 13:45767979-45768001 GTGTGGTGGGGGCGGGGGGAGGG + Intergenic
1108035520 13:46286514-46286536 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1108431978 13:50362456-50362478 GGGGTTTGGGGGAGGGAGGAGGG - Intronic
1108574873 13:51782286-51782308 GAGTGTGGGAGGAGAAAGGAGGG + Intronic
1109400922 13:61827853-61827875 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1109592785 13:64508893-64508915 GGGTGTGGGGGGAAAAAGGAGGG - Intergenic
1109772935 13:67000331-67000353 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1109894060 13:68659042-68659064 ATTTGTTGGGGGAAGAAGGGAGG - Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110033349 13:70646850-70646872 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
1110086261 13:71384702-71384724 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1110327618 13:74236086-74236108 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1110353838 13:74542211-74542233 GTGGGTTGGGGGAGCGGGGAGGG + Intergenic
1110451162 13:75638129-75638151 GAGTGTTGGGGATTGAAGGAGGG + Intronic
1110580912 13:77124270-77124292 GTGTGTTGTGGGGGGAAAAAGGG + Intronic
1110662963 13:78080015-78080037 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1110735319 13:78929125-78929147 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1110897674 13:80775915-80775937 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1111136155 13:84047018-84047040 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111937055 13:94568516-94568538 GTGGCTTGAGGGAGGAGGGAGGG - Intergenic
1112012927 13:95307248-95307270 GTGGGTGGGGGGAGGGGGGACGG + Intergenic
1112253134 13:97802183-97802205 GTATGTTGGGAGACAAAGGAAGG + Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112548181 13:100392192-100392214 AGGAGTTGGGGAAGGAAGGAAGG + Intronic
1112714278 13:102165664-102165686 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1112730499 13:102355133-102355155 GTTTGTTGAGGGATGAATGATGG + Intronic
1112740017 13:102462408-102462430 GTGTCTTTTGGTAGGAAGGAGGG - Intergenic
1113059170 13:106302601-106302623 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1113109102 13:106802843-106802865 GTGTGTTGGGGGGTGGAGGCGGG + Intergenic
1113146054 13:107208873-107208895 GGGAGGAGGGGGAGGAAGGAGGG - Intronic
1113362986 13:109648687-109648709 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1113590531 13:111496249-111496271 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1113769775 13:112900623-112900645 GTGTGTTGGGGGAAGAGGGGCGG + Intronic
1113810290 13:113137371-113137393 GGGTATTTGGGGGGGAAGGATGG + Intronic
1113901354 13:113800090-113800112 GTGTGTGGGGGGGGGTAGGCAGG + Intronic
1113901378 13:113800189-113800211 GTGTGTGGGGGGGGGTAGGCGGG + Intronic
1114004052 14:18292968-18292990 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1114011511 14:18374023-18374045 GTGGGGTGGGGGAAGAAGGGAGG + Intergenic
1114055810 14:18966277-18966299 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1114106737 14:19435485-19435507 TTGTGTGGGGGGAGGGGGGAGGG + Intergenic
1114251675 14:20967148-20967170 GAATGTTGGGGGAAGAAGGCAGG + Intergenic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1114597041 14:23921650-23921672 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1114657636 14:24325626-24325648 GATGGTAGGGGGAGGAAGGAGGG - Intronic
1114750639 14:25200904-25200926 GTGTGGTGGGGGAAAAAGGAGGG + Intergenic
1114933657 14:27506805-27506827 GTGTGCTGGAGGGGCAAGGAAGG + Intergenic
1116033189 14:39597416-39597438 GTGGGTGGGGGGTGGAGGGAGGG + Intergenic
1116038914 14:39661872-39661894 TGGTGTTGGGGGAGGGGGGAGGG + Intergenic
1116234341 14:42258493-42258515 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1116415928 14:44676732-44676754 GTGGGGTGGGGGAGGCGGGAGGG + Intergenic
1116514392 14:45787851-45787873 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1116538548 14:46066539-46066561 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
1116550220 14:46227784-46227806 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1116957601 14:50940982-50941004 GTTTGTTGGGAGAGCAAGGTGGG + Intronic
1117030176 14:51660759-51660781 GAGTGCTGGGGGAGGGAGGCAGG + Intronic
1117156279 14:52945254-52945276 GTGGGTTGGGGGCGGGGGGACGG + Intronic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1117812104 14:59558168-59558190 GTGTGTTCGAGGAAGAAGGATGG + Intronic
1117860136 14:60081757-60081779 GGGACTTGGGGGAGGAAGGATGG - Intergenic
1118104532 14:62642548-62642570 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1118182591 14:63508090-63508112 GTGTGTGGGGGTGGGAAGGAGGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118456434 14:65948986-65949008 GTGTGCTGGGGGTGGAGGGTTGG + Intergenic
1118508700 14:66445810-66445832 GGGGGGTGGGGGAGGAAGGGAGG - Intergenic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118935030 14:70279865-70279887 GAGAGTGGGGGGAGGGAGGAGGG + Intergenic
1118980983 14:70716810-70716832 ATGGGTTGTAGGAGGAAGGAGGG + Intergenic
1119472604 14:74909196-74909218 GTGTGTGGGAGGAAAAAGGAGGG + Intronic
1119635476 14:76269848-76269870 TTGTGGAGAGGGAGGAAGGAGGG - Intergenic
1119793997 14:77379278-77379300 GTATTTTGGGAGAGGAAGGGAGG + Intronic
1119838517 14:77772638-77772660 GTGAGGTGGGGCAGGAAGCAGGG + Intergenic
1120189075 14:81423624-81423646 TTTTGTTGGGGGAAGAGGGAGGG - Intronic
1120733962 14:88033086-88033108 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1120930670 14:89844940-89844962 GTGTGTTGGAGGAGGCAGTGAGG + Intronic
1121012062 14:90525684-90525706 CTGGGTTGGGCGAGGTAGGACGG - Exonic
1121246360 14:92463802-92463824 GGGGGTCGGGGGAGGAGGGAAGG - Intronic
1121314419 14:92952669-92952691 GGGTGTTGTGGGAGGCAGGCGGG - Intronic
1121367103 14:93323354-93323376 GTCTGATAAGGGAGGAAGGATGG - Intronic
1121409352 14:93738438-93738460 GGATGATGAGGGAGGAAGGAAGG + Intronic
1121496186 14:94392675-94392697 GTGTGTTGGGGAGGGGAGGGGGG + Intergenic
1121774808 14:96583662-96583684 GTGTGTTGGGGGAGGGCGGGTGG + Intergenic
1121855025 14:97260174-97260196 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1122077631 14:99246180-99246202 GAGTGTCAGGGGAGGAAGAAAGG + Intronic
1122126301 14:99580360-99580382 GTGCAGTGGGGGAGGCAGGAGGG + Intronic
1122160886 14:99783133-99783155 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1122307872 14:100776947-100776969 CTGTGTGGGGGTAGGACGGACGG + Intergenic
1122316496 14:100828519-100828541 GGGTATGGAGGGAGGAAGGAGGG - Intergenic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1123207964 14:106731975-106731997 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202875568 14_GL000225v1_random:205655-205677 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1202878046 14_KI270722v1_random:26873-26895 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1123449678 15:20351863-20351885 TGGTGATGGGGGAGGAAGGGTGG + Intergenic
1123510454 15:20993501-20993523 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1123567669 15:21567247-21567269 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1123603928 15:22004544-22004566 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1123727896 15:23123289-23123311 TGGTGTTGGGGGAGGGGGGAGGG - Intergenic
1124033581 15:26032972-26032994 GTGTGTTGGTTGGGGAAGGCAGG - Intergenic
1124259727 15:28178082-28178104 GAGGGTTGGGGGAAGAAGCAGGG - Intronic
1124264443 15:28220588-28220610 GTGAGCTGGGAGAGGACGGATGG - Exonic
1124383948 15:29190582-29190604 GTATGGGAGGGGAGGAAGGAGGG + Intronic
1124845984 15:33290412-33290434 GTGTGTGGTGGGAGGAGAGAGGG - Intergenic
1124886277 15:33689221-33689243 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1124989079 15:34652905-34652927 ATGAGTTTGAGGAGGAAGGAAGG + Intergenic
1125119515 15:36137857-36137879 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1125441510 15:39708580-39708602 GTTGGTTGGGGTAGGAGGGAAGG - Intronic
1125441511 15:39708584-39708606 GTGTGTTGGTTGGGGTAGGAGGG - Intronic
1125524009 15:40364151-40364173 GTGTGTTGGGGGTGGAGGTGGGG - Intronic
1125947715 15:43723474-43723496 GTGTTTTGGGGGAAAAGGGAAGG + Intergenic
1126377138 15:48007739-48007761 GTGTCCAGGGGCAGGAAGGAGGG + Intergenic
1126380924 15:48046075-48046097 GAATGTTGGGGAAGAAAGGAAGG + Intergenic
1126426667 15:48534996-48535018 GTGTGGTGGGAGAGATAGGAGGG - Intronic
1126506824 15:49414392-49414414 GTGTGTGGGGGGAGGGAGGGGGG + Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127382310 15:58440614-58440636 GTGTGTGGGGGCAGGGAGGTTGG + Intronic
1127419825 15:58794109-58794131 GTGCGGTGGGGGAGGAGGGGAGG + Intronic
1127582829 15:60353334-60353356 TTGTGGTGGGGGAGAAAGGGAGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127734192 15:61827121-61827143 GGGTGGTGGGGGAGGGAGAAGGG - Intergenic
1127808367 15:62541606-62541628 GTGTGTTGGAGGGGAGAGGAGGG + Intronic
1128072991 15:64808818-64808840 GTGTGTTGCGGGAGGCAGAGTGG + Intergenic
1128148282 15:65344827-65344849 GTGTGCTGTGGGATGCAGGAAGG + Intronic
1128199363 15:65791896-65791918 GTGGGTTCGGGGAGGAGGCACGG - Intronic
1128223793 15:65987659-65987681 GTGTGGTAGGGGAGGAACTAGGG - Intronic
1128307026 15:66605395-66605417 GTCTGATGGGGGAGGAGGGAGGG + Intronic
1128370834 15:67038003-67038025 TGGGGTTGGGGGAGGAAGAAAGG - Intergenic
1128499961 15:68221214-68221236 GAGGGTTGGGGGAGGGGGGAGGG - Intronic
1128705936 15:69837532-69837554 GGGTGTGGGGGGAGGGAGGGAGG + Intergenic
1129108439 15:73324032-73324054 GGGTGTTGGGGGAGGAGGGCAGG - Intronic
1129234268 15:74214345-74214367 GTGAGTGGAGGGAGGCAGGAAGG - Intergenic
1129255323 15:74330956-74330978 GTGAGATGGGGGAGGAGAGAAGG - Intronic
1129393264 15:75231146-75231168 GTGGGTTAGGGCAGGAGGGAAGG - Intergenic
1129704815 15:77788094-77788116 GTGGGTTGGGGTGGTAAGGAGGG - Intronic
1129789942 15:78334371-78334393 GTGCGCTGGGGCAGGAAGGTGGG - Intergenic
1130108493 15:80946541-80946563 ATGTGGTGATGGAGGAAGGAAGG - Intronic
1130184617 15:81668622-81668644 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1130302476 15:82690394-82690416 TGGCGTTGGGGGAGGAGGGAGGG - Intronic
1130680668 15:85993455-85993477 GTGTGTTGGGGGTGTGGGGAAGG + Intergenic
1130818823 15:87469586-87469608 GTGGGATGGGGGAGGGGGGAGGG + Intergenic
1130850543 15:87789409-87789431 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1130998608 15:88920129-88920151 GTGTGTTGGGGGCGGTAGCGGGG - Intergenic
1131347426 15:91663335-91663357 GACTGTAGGGAGAGGAAGGAAGG + Intergenic
1131593882 15:93776746-93776768 TGGGGTTGGGGGAGGCAGGAGGG + Intergenic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1131884642 15:96898707-96898729 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1132159925 15:99531231-99531253 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1202976032 15_KI270727v1_random:294341-294363 GTGGGTTGGGGGAGCGGGGAGGG - Intergenic
1132482097 16:171901-171923 GGATGTGGGGTGAGGAAGGAAGG - Intergenic
1132903729 16:2271791-2271813 GTGTGTTGAGGAAGGAAGGCAGG + Intergenic
1132943119 16:2518309-2518331 TTCTCTTGGGAGAGGAAGGAGGG + Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1133392783 16:5422880-5422902 GGGAGTGGGAGGAGGAAGGAGGG + Intergenic
1133439663 16:5810175-5810197 TAGGGTTGGGGGAGGAGGGAGGG + Intergenic
1133517852 16:6527355-6527377 CTTTGTTGGGGGAGGAAGGAAGG - Intronic
1133543781 16:6785502-6785524 GTGCTTTGGGGAAGGTAGGATGG - Intronic
1133663273 16:7939889-7939911 TTTTGAGGGGGGAGGAAGGATGG + Intergenic
1133744436 16:8675765-8675787 GTGTGTTGGGGCAGGGAGCGGGG - Intronic
1133823791 16:9259694-9259716 GTGTGTTGGGGTGGGAGGGTGGG + Intergenic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134178869 16:12031452-12031474 GAGAGCTGGGGAAGGAAGGAAGG - Intronic
1134389835 16:13809102-13809124 GTGTGTTGGGGAAGGGAGTCTGG + Intergenic
1134444801 16:14322563-14322585 GGGAGGTGGGGGAGGAAGAAGGG + Intergenic
1134506432 16:14811353-14811375 GTGTGTTGTGAAAGGAACGAGGG + Intronic
1134537795 16:15040702-15040724 GTGCTCTGGGGGAGGAAGGCAGG - Intronic
1134574122 16:15317412-15317434 GTGTGTTGTGAAAGGAACGAGGG - Intergenic
1134728299 16:16438889-16438911 GTGTGTTGTGAAAGGAACGAGGG + Intergenic
1134792685 16:17004387-17004409 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1134803562 16:17106733-17106755 GTGAGTAGGGGGAGGATGGGAGG + Exonic
1134939140 16:18272943-18272965 GTGTGTTGTGAAAGGAACGAGGG - Intergenic
1135166825 16:20146486-20146508 GTATGGAAGGGGAGGAAGGAGGG + Intergenic
1135274855 16:21103349-21103371 GTGTGTGGGGGGGGGCAGGGTGG + Intronic
1135305611 16:21365207-21365229 GAGAGCTGGGGAAGGAAGGAAGG - Intergenic
1135315167 16:21438832-21438854 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135368093 16:21871100-21871122 GTGTGGTGGGGGAGGGGGAAGGG + Intronic
1135434823 16:22419918-22419940 GTGGGATGGAGGAGGAGGGAGGG - Intronic
1135443724 16:22500049-22500071 GTGTGGTGGGGGAGGGGGAAGGG - Intronic
1135479112 16:22806445-22806467 GTGTGTGGAGCGAGGAAGGTGGG + Intergenic
1135540268 16:23324685-23324707 GTGTGTGGGGTGGGGTAGGATGG - Intronic
1135548105 16:23379100-23379122 GTGTGTGGGTGGATGATGGAGGG - Intronic
1135608173 16:23840744-23840766 ATGGGTTGGGAGAGGAAGGATGG + Intronic
1135686098 16:24499471-24499493 GTGCGTGTGTGGAGGAAGGAAGG - Intergenic
1136302353 16:29344361-29344383 GAGAGCTGGGGAAGGAAGGAAGG - Intergenic
1136311832 16:29417493-29417515 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136325274 16:29519289-29519311 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136428478 16:30184149-30184171 CTGTGGTGGGGGAGGAGGCAGGG + Intronic
1136439961 16:30259271-30259293 GTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1136661609 16:31767912-31767934 GGGGGTAGGGGAAGGAAGGAAGG + Intronic
1137063802 16:35815578-35815600 GTGTGTTGGGGCAGGCAGGGAGG - Intergenic
1137076187 16:35964749-35964771 GTCAGGTGGGGGAGGAGGGAGGG + Intergenic
1137585183 16:49659999-49660021 GGGTGGAGGAGGAGGAAGGAAGG - Intronic
1137621356 16:49878516-49878538 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1137774025 16:51040908-51040930 GAGGGATGGGGGAGGAAGGAGGG + Intergenic
1137799482 16:51249047-51249069 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1137907613 16:52339380-52339402 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1137966140 16:52935702-52935724 CTGGGGTGGGGGCGGAAGGAAGG - Intergenic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138497707 16:57418292-57418314 GTGGGGTGGGGGAGGAGGGGAGG - Intergenic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1138892397 16:61160394-61160416 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1138929263 16:61632746-61632768 GTGGGATGGGGGAGGGGGGAGGG - Intergenic
1139139689 16:64246202-64246224 AAGTGTGGAGGGAGGAAGGAGGG + Intergenic
1139301385 16:65948162-65948184 ATTTGTTGGGGGAGGAGGGCTGG - Intergenic
1139403891 16:66703186-66703208 GAGTGTTGTTGGGGGAAGGAGGG + Intergenic
1139472211 16:67184343-67184365 GTGTGTTGGGGAAGGTGGGATGG - Intergenic
1140043571 16:71425195-71425217 GTGTGTTGGGGGGGGGGGGGGGG + Intergenic
1140078380 16:71723119-71723141 GCGTGTTGCGGAAGGGAGGAGGG - Intronic
1140149340 16:72345987-72346009 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1140340743 16:74157477-74157499 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1140663084 16:77206712-77206734 GTGTGTGGGGGGAGGGAGTAGGG - Intronic
1141170644 16:81688799-81688821 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1142044009 16:87913695-87913717 GTGGGGTGGAGGAGGAGGGAGGG - Intronic
1142088222 16:88195867-88195889 GTGGGTTTGGGAAGGTAGGAGGG + Intergenic
1142095602 16:88237783-88237805 GTGAGTGGCGGGAGCAAGGAGGG - Intergenic
1142240462 16:88942274-88942296 GTGCGTTGGGGCAGGAAACAGGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142742737 17:1940571-1940593 GTGTGTTGGGGGAGGAACCTGGG + Intronic
1142947369 17:3442723-3442745 ATGTGTTGGGGAGGGAAAGAAGG - Intronic
1142980356 17:3667987-3668009 GTGGGTTGGAGGAGCAAGGCTGG + Intronic
1143000179 17:3789442-3789464 GAGGGAGGGGGGAGGAAGGAAGG - Intronic
1143290082 17:5821725-5821747 GTGGGGTGGGGGATGCAGGAAGG + Intronic
1143293255 17:5849698-5849720 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1143385093 17:6524331-6524353 GTATGTGGGGTGGGGAAGGAGGG + Intronic
1143385094 17:6524335-6524357 GTGGGGTGGGGAAGGAGGGATGG + Intronic
1143393905 17:6576793-6576815 GTGTGTTGGGGGAGTGGGGGAGG - Intergenic
1143430903 17:6883511-6883533 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1143565481 17:7717834-7717856 GTGTGTCGGGGGCAGAGGGAAGG + Exonic
1143683366 17:8494159-8494181 GTGTGGTGGGGGACGCAGGAGGG - Intronic
1143810171 17:9465134-9465156 GTGTTTTTGGTGAGAAAGGAGGG - Intronic
1143825977 17:9607765-9607787 GTGGTTTTAGGGAGGAAGGATGG + Intronic
1143929233 17:10403782-10403804 GTTTATTGGTGCAGGAAGGAGGG - Intronic
1144002358 17:11067308-11067330 GTGGGGTGGGGGACGGAGGAGGG - Intergenic
1144091486 17:11861167-11861189 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1144143671 17:12376364-12376386 GGGTGAAGGGGGAGGAGGGAGGG + Intergenic
1144182965 17:12770095-12770117 GGGTGGAGGTGGAGGAAGGATGG + Intergenic
1144185322 17:12790461-12790483 GAGGGGTGGGAGAGGAAGGAAGG + Intronic
1144230213 17:13195137-13195159 GAATGTTGGGAGAGAAAGGAAGG - Intergenic
1144665477 17:17099189-17099211 GTGTGTCCAGGGAGGAGGGAGGG - Intronic
1145375229 17:22341003-22341025 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1145769224 17:27480264-27480286 GTTAGGTGGGGGAGGCAGGAGGG - Intronic
1145852544 17:28115227-28115249 GGGTGGTGGTGGAGGAAGAAGGG - Intronic
1145990026 17:29073736-29073758 GTGTGTGGGGGCAGGGAGGTTGG + Exonic
1146240704 17:31221085-31221107 CTGGGTTGGGGGTGGAGGGATGG + Intronic
1146289670 17:31598418-31598440 ATGTGGTGGGGTAGGAAGGAAGG - Intergenic
1146540352 17:33688089-33688111 GTGTGTTGGGGGTGGCCTGAGGG + Intronic
1146580025 17:34029068-34029090 GTGTTGTGGGGGAGGTAGGAGGG - Intronic
1146623811 17:34420879-34420901 GTGAGTTTGGGGAGGAGGGAAGG - Intergenic
1146656826 17:34639468-34639490 GCATGTTGGGGGAGGAAGAGCGG - Intergenic
1146688312 17:34856573-34856595 GGGGGGTGGGGGAGGACGGAGGG + Intergenic
1146762837 17:35493171-35493193 GTGTGTGAGGGGAGGAAGCCAGG - Intronic
1146911399 17:36650704-36650726 GACAGTTGGGGGAGGAAGGGTGG - Intergenic
1147035940 17:37680771-37680793 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1147306681 17:39569044-39569066 GGGTGTGGGAGGAGGAAGGGTGG - Intergenic
1147332139 17:39705447-39705469 GTCTGTTGGGGGAGGAAGTGTGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148111772 17:45148546-45148568 GTGGGAAGGGGGAGGAGGGAGGG + Exonic
1148135800 17:45290831-45290853 TTGGGTTGGGGGAGAAAGGCAGG + Intronic
1148466613 17:47868814-47868836 GCGGGATGGGGGAAGAAGGAGGG + Intergenic
1148485572 17:47988664-47988686 GTGTGGGGGGAGGGGAAGGATGG - Intergenic
1148612540 17:48973934-48973956 TTGTGTGGGGGCATGAAGGATGG + Intergenic
1148768377 17:50052738-50052760 ATGTGTTGGGAGAGCCAGGAAGG + Intergenic
1148788021 17:50155240-50155262 GTGTGTTGGGGGGCGGGGGAAGG + Intergenic
1148789745 17:50166513-50166535 GTATTTTAGGGGAGGAAGGTGGG + Intronic
1148909751 17:50935122-50935144 GTGTGGCGGGGGAGGGAGCAAGG - Intergenic
1149126856 17:53245126-53245148 GTGTGCGGGGGGAGGGAGGTGGG - Intergenic
1149170831 17:53809358-53809380 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1149302573 17:55318571-55318593 ATGTGATGGGGGAGGAATGGGGG - Intronic
1149540415 17:57464108-57464130 GGGAGTTGAGGAAGGAAGGAAGG + Intronic
1149560566 17:57605278-57605300 GTGTGTTGGGGGAGGCCGGGTGG + Intronic
1149644358 17:58228959-58228981 GGGGGGTGGGGGAGGGAGGAGGG - Intronic
1149729012 17:58925842-58925864 GAGTTTTGAGGGAGAAAGGAGGG + Intronic
1149782652 17:59410194-59410216 CAGTGTTGGGGGGGCAAGGAAGG + Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150152034 17:62817863-62817885 GTGGGGAGGGGGTGGAAGGAAGG + Intergenic
1150250540 17:63702012-63702034 GTGTGTGGGGGGGGGAGGGCGGG + Intergenic
1150313063 17:64145429-64145451 GTGTGTTGGGGGGGGGCGGCGGG + Intergenic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1151105461 17:71611423-71611445 ATGTGTTGGGGCTGGAGGGAGGG - Intergenic
1151258894 17:72901366-72901388 GTGGGTTGTGGGTGGAAGGCAGG + Intronic
1151325398 17:73376863-73376885 GGGTGAAGGAGGAGGAAGGAAGG - Intronic
1151425358 17:74027710-74027732 CTGAGATGAGGGAGGAAGGAGGG + Intergenic
1152099516 17:78292800-78292822 GATTGTTGAGGAAGGAAGGAAGG - Intergenic
1152469642 17:80483617-80483639 CTGTGTTGGGGGTGCAGGGAAGG - Intergenic
1153342590 18:3990483-3990505 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1154238283 18:12627203-12627225 GTGGGGTGGGGGAGGGAGGAGGG - Intronic
1154308048 18:13244685-13244707 GTGTCTTGGGGGAAGAGGGAAGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154493111 18:14936400-14936422 GTTTGTGGAGGGAGGGAGGAAGG - Intergenic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155248770 18:23936379-23936401 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1155316128 18:24571998-24572020 GTGTGTTGGGAGAAGACTGAGGG - Intergenic
1155748334 18:29389291-29389313 GTGGGCTGGGGGGTGAAGGAGGG - Intergenic
1155803014 18:30132427-30132449 GCCTGTCGGGGGAGGAAGGAGGG + Intergenic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156262547 18:35458877-35458899 GTGGGTTTGGGGAGGAGGCATGG - Intronic
1156280612 18:35633543-35633565 GTGGGATGGGGGAGGGGGGAGGG + Intronic
1156280999 18:35638451-35638473 GTGTGTGGGGTGGGGAAGGGGGG - Intronic
1156343560 18:36235273-36235295 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1156466266 18:37349425-37349447 GCGGGTTTAGGGAGGAAGGAGGG + Intronic
1156524421 18:37753189-37753211 GTGTGTTGGGGGAGGCGGGTAGG + Intergenic
1156565594 18:38185490-38185512 GTGTGTTGGGGAGGGGGGGAAGG + Intergenic
1156733950 18:40229962-40229984 GTGGGTGGGGGGAGGGAGGAGGG - Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157280589 18:46344389-46344411 GTGGCATGGGGGAGGAAGGCTGG - Intronic
1157287463 18:46386822-46386844 GTCTGCTGTGGGAAGAAGGAAGG - Intronic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157772854 18:50365120-50365142 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1157780119 18:50430853-50430875 GAGTGATGGGGGAGGCAGGCAGG + Intergenic
1157893087 18:51437520-51437542 GTGGATTGGGGGAGAAAGGCAGG - Intergenic
1158190225 18:54819762-54819784 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1158212226 18:55064672-55064694 CTGGGTGGTGGGAGGAAGGAAGG + Intergenic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159501699 18:69279761-69279783 GTTTAGTGGGGGTGGAAGGATGG - Intergenic
1159789265 18:72757487-72757509 TTGGGTTGGGGGAGGAGGTAGGG - Intronic
1159822690 18:73166134-73166156 GTGGGATGGGGGAGGGGGGAGGG - Intronic
1160105799 18:75974899-75974921 GGAAGTTGGGGGAGGAAGGAGGG - Intergenic
1160114555 18:76065145-76065167 GTGTGGTGGGGGTGGAGTGAGGG - Intergenic
1160410186 18:78670656-78670678 GTGGGGTGGGTGGGGAAGGAGGG - Intergenic
1160453957 18:78983699-78983721 GTGTGCTGGGGGAGCACTGAGGG - Intronic
1160572479 18:79827534-79827556 CTGTGTTCCTGGAGGAAGGAGGG + Intergenic
1160583113 18:79898920-79898942 GTGGGTTGGGGCGGGAAGGGTGG + Intronic
1160606053 18:80050154-80050176 GTATTTTGGGGGAAGAATGAGGG + Intronic
1160730357 19:639236-639258 GTGTGTTTGGGCAGGTAGGTGGG - Intergenic
1160872118 19:1282335-1282357 GTGGGAAGGGGGAGGAGGGAGGG + Intergenic
1161028845 19:2048772-2048794 GGCTGCTGGGGGAGGAGGGAAGG + Intronic
1161241364 19:3225392-3225414 GTGGGGTGAGGGAGGGAGGAAGG - Intronic
1161404087 19:4082076-4082098 GGCTCTTGGAGGAGGAAGGAGGG - Intergenic
1161453067 19:4357435-4357457 GGCTGTGGGGGGAGCAAGGAGGG + Intronic
1161467855 19:4442131-4442153 CCGTGTTGGGGGTGGGAGGAAGG + Intronic
1161492194 19:4568114-4568136 GTGTGATGGGGGAGGAGAGGAGG - Intergenic
1161585586 19:5103756-5103778 CTGTGTTGGAGAAGGATGGAGGG + Intronic
1161756429 19:6137460-6137482 GTGAGGAGGGGGAGGGAGGAAGG + Intronic
1162582609 19:11540035-11540057 GTGAGTGGGGGGAGGTGGGAGGG - Intronic
1162639531 19:11997227-11997249 CTTTCTTTGGGGAGGAAGGAGGG - Intergenic
1162762612 19:12897438-12897460 GTGTGGTGGGGGCGGGGGGATGG + Intronic
1163009730 19:14417485-14417507 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
1163076900 19:14901156-14901178 GAGTGTTGAGGGTGGTAGGAGGG + Intergenic
1163093828 19:15041298-15041320 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1163536733 19:17881210-17881232 ATTTGTCTGGGGAGGAAGGAAGG - Intronic
1163667592 19:18610575-18610597 GGTTGTTGGGGGAGGACGGAGGG - Intronic
1163781959 19:19255207-19255229 GGGAGGTGGGGGAGGAATGAAGG + Intergenic
1164327310 19:24207299-24207321 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1164367011 19:27596647-27596669 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
1164394302 19:27850381-27850403 GGGTGTGGGGTGAGGAGGGAGGG + Intergenic
1164421074 19:28093324-28093346 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1164496403 19:28767910-28767932 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1164554639 19:29241808-29241830 GTGACTTGGGGGAAGAAAGAAGG - Intergenic
1164708338 19:30336665-30336687 GTGTCTGGGGGCAGGAGGGAGGG + Intronic
1164714799 19:30383862-30383884 GAGGGAGGGGGGAGGAAGGAAGG - Intronic
1164854914 19:31513217-31513239 GTGGGGTGTGGGAGGAGGGAAGG - Intergenic
1165149644 19:33753410-33753432 GTGGGTGGTGGGAGGAAGGTGGG - Intronic
1165149653 19:33753432-33753454 GTGGGTGGTGGGAGGATGGAGGG - Intronic
1165482396 19:36072360-36072382 GTGTGTCCGGGGAGGATGGTGGG + Intronic
1165486667 19:36100781-36100803 TTCTGCTGGGGCAGGAAGGAGGG - Exonic
1165577895 19:36837444-36837466 GTTTGTGGAGGGAGGAAGAAAGG - Intronic
1165600184 19:37048858-37048880 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165745527 19:38228249-38228271 GGGAGTTGGGAGAGGAAGGGGGG - Intronic
1165773722 19:38392866-38392888 ATGTGTGGGGGCAGGAGGGAAGG - Intronic
1165779355 19:38423203-38423225 GAGGGCTGTGGGAGGAAGGAGGG - Intronic
1166231337 19:41427218-41427240 GGGTGTTGCGGGAGGCAGGCTGG - Intronic
1166240855 19:41492359-41492381 GTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1166252938 19:41584060-41584082 GAGTGATGTGAGAGGAAGGAGGG + Intronic
1166301744 19:41915115-41915137 GGGGGCGGGGGGAGGAAGGAGGG - Intronic
1166354280 19:42217729-42217751 GCGAGTTGGGGGAAGGAGGAGGG - Intronic
1166568332 19:43778716-43778738 GTGGGGTGGAGGAGGAGGGATGG - Intronic
1167348687 19:48962286-48962308 GGGAGTGGGGGGAGGAGGGATGG + Intergenic
1167473235 19:49686790-49686812 GAGTGGTGGGGGAGGAATGGTGG + Intronic
1167596468 19:50430919-50430941 GTGGGAAGGGGGAGGGAGGAAGG + Exonic
1167600392 19:50451429-50451451 ATGAGTGGGGAGAGGAAGGAGGG + Intronic
1167608784 19:50496214-50496236 GGGGGTGGGGGGAGGAAAGAAGG + Intergenic
1167741944 19:51329163-51329185 GGGTTTTGGGGGCGGGAGGACGG - Exonic
1167773971 19:51542830-51542852 GTGGGTTGGGGGAAGAAGATGGG + Intergenic
1167995561 19:53399226-53399248 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1168376967 19:55888236-55888258 GTGAGTTCATGGAGGAAGGACGG + Intergenic
1202672633 1_KI270710v1_random:6056-6078 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
925090837 2:1154779-1154801 ATGTGTTGGAGGTAGAAGGAAGG - Intronic
925419811 2:3703243-3703265 GAGTGTAGGGGGAGGAGGCACGG + Intergenic
925818367 2:7775400-7775422 GGGGGTTGTGGGGGGAAGGAGGG + Intergenic
925849721 2:8068575-8068597 GTGTGCTGGGAGAGGGAGAAGGG - Intergenic
925873267 2:8289332-8289354 ACATGTTGTGGGAGGAAGGAGGG - Intergenic
925983305 2:9194353-9194375 GTGGGGTGGGGGTGGGAGGAGGG - Intergenic
926052000 2:9751311-9751333 GTGAGCTGGGTGAGGAAGGAGGG - Intergenic
926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG + Intergenic
926244448 2:11112906-11112928 GTATGGTGAGGAAGGAAGGAAGG + Intergenic
926244456 2:11112948-11112970 GTATGGTGAGGAAGGAAGGAAGG + Intergenic
926315065 2:11703741-11703763 GTATGTGGGGGGAGGAGGAAGGG - Intronic
926589995 2:14730279-14730301 GTGTGTTGGGGGTGGGGGGTGGG + Intergenic
926727199 2:16007838-16007860 GTGTGTTGGGGGTGGGGGGTTGG + Intergenic
926754321 2:16223392-16223414 TGGTGTTGGGGGAGGGAGGCTGG - Intergenic
926770621 2:16371056-16371078 GTGTGGAGGGGGAGAAAGAAAGG - Intergenic
926781237 2:16473995-16474017 GTTTGTAAGGGGTGGAAGGAGGG + Intergenic
926796694 2:16625415-16625437 GTGAAGTGGGGGAGGAGGGAAGG + Intronic
926842401 2:17096788-17096810 GTGGGATGGGGGAGGGGGGACGG - Intergenic
927050117 2:19319826-19319848 ATGTGCTGGGGCAGGAAGGAAGG + Intergenic
927108427 2:19847121-19847143 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927218177 2:20681827-20681849 GGGTGTTGGTGGAGGCAGGGAGG + Intergenic
927361973 2:22246424-22246446 GGGGGTTGGGGGAGGTGGGATGG + Intergenic
927397642 2:22672280-22672302 GGGTGTGGAGGGAGGAAGAAAGG + Intergenic
927414611 2:22865826-22865848 GTGTGGTGGGGGTGCAGGGATGG + Intergenic
927477977 2:23428595-23428617 GTGTGTGGCGGGGGGTAGGATGG - Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927548549 2:23976661-23976683 GTGTGTTGTGGGAGGGACCAAGG - Intronic
927706937 2:25302232-25302254 GTGTGTTGTGGGAGCAAGGAAGG + Intronic
927926816 2:27019331-27019353 GAGTGCTGGGGGAGGGAGGATGG + Intronic
928179070 2:29055010-29055032 GTGGGGTGGGGGAGGGGGGAGGG - Exonic
928277918 2:29919853-29919875 GAGGTTTGCGGGAGGAAGGAGGG + Intronic
928435796 2:31253734-31253756 GTGTCTTGTGGGAAGAAGGCTGG + Intronic
928535190 2:32233119-32233141 GAGGGGTGGGGGAGGGAGGAAGG + Intronic
928665753 2:33549029-33549051 GTGAGTAGGGGTAGGAAGGTGGG + Intronic
929109663 2:38396125-38396147 GTTTGTGGGGAGAGGGAGGAGGG - Intergenic
929687496 2:44047231-44047253 GAGTGAAGGGGGAGGATGGATGG + Intergenic
929815226 2:45225326-45225348 GCGTGTTGGGGGTGGATGCAGGG - Intergenic
929994395 2:46816365-46816387 GGATGTTGGGAGAGGGAGGAAGG + Intergenic
930248376 2:49008168-49008190 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
930452161 2:51555771-51555793 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
930624346 2:53679890-53679912 CTATGTTGTGGGTGGAAGGAAGG - Intronic
930822599 2:55662268-55662290 GAGTGCTGGGGAAGGAAGGCAGG + Intronic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931216288 2:60248023-60248045 AAGTGTTAGAGGAGGAAGGAAGG + Intergenic
931757818 2:65389390-65389412 GTGTGTTGGGGGAGGAAGGAGGG + Intronic
931797745 2:65727933-65727955 GTGTGTGGGGGCAGGGGGGAAGG + Intergenic
932310185 2:70733556-70733578 GCCTGTTGAGGAAGGAAGGAAGG + Intronic
932312654 2:70756166-70756188 GTATGTTGGGGGAGGAAAGGGGG - Intronic
932341435 2:70964905-70964927 ATGTGTGTGGGGCGGAAGGAGGG - Intronic
932413229 2:71559391-71559413 GAGGGGTGGGAGAGGAAGGAAGG - Intronic
932437868 2:71713454-71713476 GAGTTTTGCTGGAGGAAGGAAGG + Intergenic
932577055 2:72968425-72968447 GTGAGTTGGGGCAGCCAGGATGG - Intronic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
933185789 2:79278044-79278066 GGGTGGTGGAGGATGAAGGAAGG + Intronic
933365945 2:81354107-81354129 GAGGGTTGGGGGTGGAAGAAGGG + Intergenic
933833028 2:86225762-86225784 TGGTGTCAGGGGAGGAAGGAAGG - Intronic
933850016 2:86358574-86358596 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
933981092 2:87551482-87551504 GTGAGTAGGGGATGGAAGGAGGG + Intergenic
934661191 2:96144612-96144634 GTGTGTTGGGGGAGGGGGTGGGG - Intronic
934766650 2:96883615-96883637 GTGTGTTGGGGGGAGAACCAAGG + Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
935691080 2:105733103-105733125 GTGAGATGGGGAAGGAAGGAAGG + Intergenic
935903598 2:107818742-107818764 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
935919850 2:108001142-108001164 GTGGGTGGGGGGAGGAGGGGAGG - Intronic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936506071 2:113108401-113108423 GTGGGGTGGGGGAGGGGGGACGG - Intronic
936839121 2:116748637-116748659 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
937075442 2:119101693-119101715 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
937558049 2:123183989-123184011 AGGGGTTGGGGGAGGAAGGGAGG + Intergenic
937802963 2:126102263-126102285 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
937821600 2:126316684-126316706 GGGTTGTGGGGAAGGAAGGAAGG - Intergenic
937856492 2:126675382-126675404 GTGTGATGGGAGATGTAGGAGGG - Intronic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
938204732 2:129410750-129410772 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
938281917 2:130069909-130069931 GTGGGGTGGGGGAGGAGGGAGGG + Intergenic
938289987 2:130143914-130143936 GAGGGGTGGGGGAGGAGGGAGGG + Intronic
938332537 2:130458464-130458486 GTGGGGTGGGGGAGCAGGGAGGG + Intergenic
938357269 2:130662204-130662226 GTGGGGTGGGGGAGCAGGGAGGG - Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938433701 2:131268991-131269013 GTGGGGTGGGGGAGGAGGGAGGG - Intronic
938466537 2:131529023-131529045 GAGGGGTGGGGGAGGAGGGAGGG - Intronic
938567725 2:132534839-132534861 TGGGGTTGGGGGAGGAGGGAGGG + Intronic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
939302750 2:140367042-140367064 TTCTGTTTTGGGAGGAAGGAAGG + Intronic
939348574 2:141001461-141001483 GTGAGGTGGGGGACGGAGGAGGG - Intronic
939461288 2:142499119-142499141 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
939485431 2:142806417-142806439 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
939542784 2:143513869-143513891 GGCTCTTGGGGGAGGGAGGATGG - Intronic
939647545 2:144719635-144719657 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
939648746 2:144735747-144735769 GTGTGTTGGGGAGGGGAAGAGGG + Intergenic
939688471 2:145228059-145228081 GTGTGGTGGGGGAGAAAATATGG + Intergenic
939767365 2:146267400-146267422 GGGTTTTGGGGGGTGAAGGAGGG + Intergenic
939964238 2:148594935-148594957 GTGTGGTGAGGGAGGCAGGGAGG + Intergenic
940154697 2:150643197-150643219 GTGTGCTGGGGGAGGATGGAGGG - Intergenic
940432852 2:153613862-153613884 GTGGGGTGGGGGAGCAGGGAGGG + Intergenic
940531868 2:154887394-154887416 GGCTGTTGGGGGAGGAAGTTGGG - Intergenic
940568707 2:155403318-155403340 GCATGTTTGGGGAGAAAGGAAGG + Intergenic
940627229 2:156190383-156190405 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
940643895 2:156370404-156370426 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
940705215 2:157097398-157097420 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
940730776 2:157388506-157388528 GAGGGTGGAGGGAGGAAGGAGGG - Intergenic
940993430 2:160120910-160120932 GTGGGATGGGGGAGGGGGGAGGG + Intronic
941106728 2:161363222-161363244 GAGTTTTGGGGCAGGGAGGATGG - Intronic
941221982 2:162793300-162793322 GTGTGGTGTAGGAGGAGGGAGGG + Intronic
941508133 2:166373348-166373370 GTTTGTTAGGGGAGACAGGATGG + Intronic
941683002 2:168419213-168419235 TTGTGGTGGGGGTGGAAGGGTGG + Intergenic
941726980 2:168871206-168871228 GTGGGTTGGGGGAGGGGGGAGGG + Exonic
941775959 2:169394046-169394068 TGGAGTTGGGGGAGGAGGGAGGG - Intergenic
941819382 2:169828605-169828627 GAGGGTTGAGGGAGGAGGGAAGG + Intronic
941915377 2:170809514-170809536 GTGTGTTAGGGAAGGAAACAAGG + Intergenic
942264723 2:174211164-174211186 GTGTGTTGTGGGGAGGAGGAAGG - Intronic
942764831 2:179443005-179443027 GTAGGGTGGGGGAGGAAGTAGGG + Exonic
942789785 2:179747523-179747545 GTGTGTTGGGTGAGGCAGAGAGG - Intronic
942818523 2:180081778-180081800 GTCTTTTGGGGGAAGATGGATGG - Intergenic
942872946 2:180757656-180757678 ATGTTTTGGGGGAGAAAAGAAGG - Intergenic
943113396 2:183636419-183636441 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
943185927 2:184607584-184607606 GTGTCATGGGGGTGGAAGGGGGG - Intronic
943377569 2:187098852-187098874 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
943507908 2:188785133-188785155 GAGGGTTGGGGGTGGGAGGAGGG + Intronic
943828235 2:192424499-192424521 GTGAAGTGGTGGAGGAAGGAGGG - Intergenic
943851619 2:192730372-192730394 GTATTTTGGGGGAGGCAAGAAGG - Intergenic
944312821 2:198253577-198253599 GTGTGTTGGGGGTGGTGGGCAGG + Intronic
944402599 2:199345413-199345435 GTTTGTGGGGGGAGGGGGGAGGG - Intronic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
944783502 2:203043746-203043768 GTGTGTTGAGGGGAGAAGGGAGG + Intronic
944822607 2:203445735-203445757 GGGTGATGGGAGAGGAAGGAAGG + Exonic
945001638 2:205357175-205357197 GTGTGTTGTGGGAGGAGAGAAGG + Intronic
945107836 2:206332736-206332758 TTGAGTTGGGAGAGCAAGGAAGG + Intergenic
945179978 2:207081998-207082020 GTGTGTTGGGGGCAGAAAGGAGG + Intronic
945192797 2:207207558-207207580 CAGTGTTGGGGGAGGTAGGTCGG - Intergenic
945231232 2:207592551-207592573 TGGGGATGGGGGAGGAAGGAGGG - Intronic
945324117 2:208463164-208463186 ATGAGATGGGGGAGGAAGAAGGG - Intronic
945417970 2:209598589-209598611 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
945865674 2:215172374-215172396 GGGGGTTGGGGGAGGTGGGAGGG - Intergenic
946100190 2:217313932-217313954 GTGTGTTTGGGAGGGGAGGAGGG + Intronic
946364827 2:219242624-219242646 GTGTGGTGGGGAAGCTAGGAAGG + Intronic
946571409 2:221027987-221028009 GTGGGGTGGGGTAGGGAGGAGGG + Intergenic
946590545 2:221242574-221242596 GTGTGGTGGGGGAGAGGGGAGGG + Intergenic
946591804 2:221257673-221257695 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
946611079 2:221458693-221458715 GTGTTATGGGGGTGGAAGGAGGG + Intronic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
946989113 2:225308090-225308112 TTGGATTGGGGGAGGAATGATGG + Intergenic
947018054 2:225643585-225643607 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
947191447 2:227510144-227510166 GTGTGTTGAGGGGGGTAGGGAGG + Intronic
947245724 2:228046063-228046085 GTGTGTAGGGGGTGGGATGAAGG - Intronic
947312870 2:228823482-228823504 AAAAGTTGGGGGAGGAAGGAAGG - Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947456247 2:230256522-230256544 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
947573114 2:231250758-231250780 CTGTGTTGAGTGTGGAAGGAGGG + Intronic
947947750 2:234120932-234120954 ATGTGTTGGCAAAGGAAGGATGG - Intergenic
948079322 2:235192612-235192634 GTGGGGTGGGGGAGGGAGGAGGG - Intergenic
948187644 2:236034384-236034406 GAGGGGTGGGGGAGGAAGGTGGG - Intronic
948524242 2:238560423-238560445 GTGTGCTGGGAGAGGGAGGGTGG - Intergenic
948550796 2:238771969-238771991 GGGTGTTGGGGGATGAGGCAGGG + Intergenic
948695715 2:239732174-239732196 GAGGGTGGAGGGAGGAAGGAAGG - Intergenic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
948824475 2:240567711-240567733 CTGTGCTGGGGTACGAAGGAGGG - Intronic
948856287 2:240732053-240732075 GAGGGATGGGGGAGGAGGGAAGG + Intronic
1169392234 20:5199547-5199569 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1169629902 20:7619167-7619189 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1169702749 20:8466323-8466345 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1170112224 20:12818162-12818184 GTGGGGTTGGGGAGGAGGGAGGG - Intergenic
1170179326 20:13511747-13511769 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1170180200 20:13521631-13521653 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1170329011 20:15187976-15187998 GTGTGTAGGGGATGGATGGAGGG - Intronic
1170384324 20:15799434-15799456 GTGGGTGGGAGGAGGAATGAAGG - Intronic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1170572084 20:17638145-17638167 GTGTGTTAGAGGAGGAAGTGCGG - Intronic
1170611638 20:17918531-17918553 GTGTGTTGTGGGTTGGAGGAAGG + Intergenic
1170726212 20:18929381-18929403 GCCTGTTGGGGGTGGGAGGAAGG - Intergenic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1170881043 20:20296515-20296537 TTGAGTGAGGGGAGGAAGGAAGG - Intronic
1170929092 20:20752681-20752703 GTGGTTTGGGTGGGGAAGGAGGG - Intergenic
1171013470 20:21521300-21521322 GTGTGTTGTGGGAGGAGGTTGGG + Intergenic
1171045640 20:21807903-21807925 GTGTGCTGAAGCAGGAAGGAGGG - Intergenic
1171736154 20:28788456-28788478 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1171772680 20:29336453-29336475 GTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1171944657 20:31365869-31365891 GTCTTCTGGGGGAGGCAGGAGGG + Intergenic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1173054113 20:39594817-39594839 GTGTGTTTGGGGAAAAAGAAAGG + Intergenic
1173171799 20:40731770-40731792 GTGGGGTGGGGGAGGGGGGACGG + Intergenic
1173290800 20:41713311-41713333 GTGTGTCTTGGGAAGAAGGAAGG - Intergenic
1173531867 20:43775934-43775956 ATGTGATGAGTGAGGAAGGAAGG - Intergenic
1173653776 20:44684775-44684797 GTGTGTGGGGGGGGGAGGGGAGG + Intergenic
1174363989 20:50045191-50045213 GTGTGGTGGGGGAATAAGGTGGG - Intergenic
1174536268 20:51253953-51253975 GTGGGGTGGGGGATGAAGGGAGG - Intergenic
1174845700 20:53941124-53941146 GTGTGAAGTGGGAGGAGGGAGGG + Intronic
1175027310 20:55915845-55915867 GGGTATTTGGGGAGGAAGGTTGG + Intergenic
1175413238 20:58785129-58785151 GGGTTTTGGGGGAGGAAAGCGGG + Intergenic
1175526519 20:59638365-59638387 GTGGGTTGGTGGTGGATGGATGG + Intronic
1175569237 20:60006531-60006553 TTGTGTTGGGGGAGAGAGGGAGG - Intronic
1175681812 20:60994783-60994805 GTGGGATGGGGGAGGGAGGCAGG - Intergenic
1175875618 20:62227955-62227977 GTCTGTTTGGGGAGGAAGCAAGG + Intergenic
1175875803 20:62228632-62228654 GTGTGCTGGGGGAGGAAGGATGG + Intergenic
1175935255 20:62511018-62511040 CTGAGTTGGGGCAGGAAGGCAGG + Intergenic
1175948377 20:62569350-62569372 GTGTGTGGTGGGAGGTGGGATGG - Intronic
1176316376 21:5248475-5248497 GTGGGTTGGGGGAAGAGGGCTGG - Intergenic
1176372868 21:6073139-6073161 GTGTGTTGGGGGGGGGTGGGGGG - Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1177478709 21:21657869-21657891 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1177884836 21:26734771-26734793 GGATGATGGGGCAGGAAGGAAGG - Intergenic
1177983853 21:27948628-27948650 GTGTGTTGTGTGAGGGAGGAGGG - Intergenic
1178282289 21:31293944-31293966 GTTTGTTGGGAGGGGAGGGAGGG - Intronic
1178627069 21:34227205-34227227 GTATGATGGGAGAGGATGGATGG + Intergenic
1179066322 21:38028080-38028102 GTGTGTCGGGGGAGCAGGGAGGG + Intronic
1179141145 21:38726553-38726575 TTGTGTCAGGGAAGGAAGGAAGG - Intergenic
1179196044 21:39163490-39163512 ATGTGTTGAAGCAGGAAGGATGG - Intergenic
1179392143 21:41003668-41003690 GTGTGTTGGGGGGGGAGAGAGGG + Intergenic
1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG + Intergenic
1179950961 21:44708656-44708678 GTGGGCTGAGGGAGGAATGAGGG - Intronic
1180070859 21:45435265-45435287 GGGGGTGGGGGGAGGGAGGAAGG + Intronic
1180116600 21:45710296-45710318 TGGGGTTGGGGGAGGCAGGAGGG - Intronic
1180386957 22:12186114-12186136 GGGGGTTGGGGGCGGAGGGAGGG - Intergenic
1180389833 22:12218498-12218520 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1180416107 22:12715982-12716004 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1180428566 22:15223767-15223789 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1180436005 22:15304827-15304849 GTGGGGTGGGGGAAGAAGGGAGG + Intergenic
1180474289 22:15688830-15688852 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1180518245 22:16168997-16169019 GTGGGGTGGGGGAAGAAGGGAGG + Intergenic
1181096934 22:20511773-20511795 TGCTGTTGGGGGAAGAAGGATGG - Intronic
1181458487 22:23072578-23072600 GTGTGTTGGGTGGGGAGGGTAGG - Intronic
1181677709 22:24467628-24467650 GTCTATTGGGGGTGGAAGGGAGG + Intergenic
1182025863 22:27118694-27118716 ATGTGTTGGGGGTGGTGGGATGG + Intergenic
1182145566 22:27994838-27994860 GTGTGTAGTGGCAGCAAGGACGG + Intronic
1182445378 22:30386796-30386818 GTGTGGTGGGGGAGGGAGCCGGG + Intronic
1182478411 22:30589844-30589866 GGGTGATGGGTGAGGGAGGAAGG - Intronic
1182974648 22:34611750-34611772 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1182997007 22:34822772-34822794 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1183171219 22:36189689-36189711 GTATATTGGGGGAGGAAGAGAGG - Exonic
1183251834 22:36735766-36735788 GTGTGTTGGGTGAGTAGAGAAGG + Intergenic
1183466922 22:37984573-37984595 GAGGGCTGGGGAAGGAAGGAGGG + Intronic
1183501131 22:38180097-38180119 GTGTGCTGGGGGAAGTAGGTAGG - Intronic
1183966667 22:41446520-41446542 GAGGGTTGGGGGACGAAGCAGGG + Exonic
1183986641 22:41573921-41573943 GTGCGTTGGGAGAGGAGGGCTGG + Intronic
1184096098 22:42317374-42317396 GTGTGGTGGGGAAGGAGGGGCGG + Intronic
1184104933 22:42362013-42362035 GTGCGGTGGAGGTGGAAGGAAGG + Intergenic
1184279069 22:43426877-43426899 GCGGGTTTGGGCAGGAAGGAAGG + Intronic
1184345541 22:43910431-43910453 GTGGGTTGCAGGAGGAGGGAAGG - Intergenic
1184538167 22:45101571-45101593 GAGAGTTTGGGGAGGTAGGAGGG - Intergenic
1184583352 22:45431307-45431329 GTCTGCTGGGGGAGTCAGGAAGG + Intronic
1184787317 22:46678180-46678202 GTTGGTTGGGGGAGGAAGTGGGG + Exonic
1184898681 22:47429636-47429658 GAGTGTTGGAGGAGGTGGGATGG + Intergenic
1184958946 22:47914803-47914825 GTGTGTTGGGGGCGGGGGGTGGG + Intergenic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
949244330 3:1907755-1907777 GTGTGTTGGGGAGGGAGGAAAGG + Intergenic
949570386 3:5286417-5286439 GTGTGTGGGGTGGGGAATGAAGG + Intergenic
949576479 3:5343405-5343427 ATTTGAAGGGGGAGGAAGGAGGG + Intergenic
949646503 3:6101285-6101307 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
949683906 3:6546749-6546771 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
949694966 3:6683761-6683783 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
950059896 3:10061969-10061991 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
950360004 3:12443456-12443478 GGGTGCTGGGGGAGGAGGAATGG + Intergenic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950919786 3:16682590-16682612 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
950961333 3:17111162-17111184 GTGTGTGGGCTGAAGAAGGAAGG - Intergenic
950969107 3:17168654-17168676 ATGTGCTGGTGGAGGAAGGGAGG + Intronic
950998132 3:17526909-17526931 GTCTGTTGAGGAAGGAAAGAAGG + Intronic
951098550 3:18659777-18659799 GTGGGTAGAGGGTGGAAGGAGGG + Intergenic
951134755 3:19092407-19092429 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
951179166 3:19638643-19638665 GTGGGGTGGGGGAGGGAGGAGGG + Intergenic
951363509 3:21752008-21752030 GTGTGGTGGGGGGGGGAGGGGGG - Intronic
951491653 3:23276213-23276235 GTGTCTTGGTGGGGGAAGGTAGG - Intronic
951498359 3:23355229-23355251 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
951505201 3:23437139-23437161 GTGTGTGGGAAGTGGAAGGAAGG - Intronic
951614210 3:24523166-24523188 GTGTGTGGGGGGGGGAGGGTGGG + Intergenic
952148275 3:30557789-30557811 GTATGTTTCAGGAGGAAGGATGG - Intergenic
952280665 3:31920143-31920165 GTGGTTTAGGGGAGGAAGGGAGG + Intronic
952770857 3:36999002-36999024 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
952882409 3:37992951-37992973 GAGTGGAGGGGGAGGAGGGAAGG + Intronic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953194970 3:40723804-40723826 GGGTGTTTGGGGAGAAGGGATGG - Intergenic
953198954 3:40759855-40759877 GTGGGGTGGGGGAGGGCGGAGGG + Intergenic
953367037 3:42353948-42353970 GTGGGTGGGAGGAGGAAGGTAGG - Intergenic
953782579 3:45884594-45884616 GAGTCTCGGGGGAGGAAGGAAGG - Intronic
953902043 3:46848981-46849003 GTGGGTTGGGGGAAGCAAGAAGG - Intergenic
953905424 3:46866101-46866123 GGGAGTTGGGGGTGGAGGGAGGG + Intronic
954150493 3:48654836-48654858 GTGTGTGGGAGGAGGGAGTATGG + Intronic
954155961 3:48685172-48685194 CGGGGTTGGGGGAAGAAGGAAGG + Intronic
954248052 3:49347222-49347244 GTGTGGTTAGGGATGAAGGATGG + Intergenic
954370179 3:50166099-50166121 GGGAGTAGGGGGAGGAAGGAAGG - Intronic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
954916369 3:54151410-54151432 GATAGTTGGGGGAGGGAGGAAGG + Intronic
955390286 3:58517607-58517629 GTGTGTTGGGGGGGGGAGCGGGG + Intronic
955561001 3:60190614-60190636 GTGGGGTGGGGGAGCAGGGAGGG + Intronic
955569215 3:60286025-60286047 GTGTAGAGGGGGAGGAAGCAGGG + Intronic
955619791 3:60850556-60850578 GTGTGTTTGGGAAGGAGGTAGGG - Intronic
955865534 3:63379828-63379850 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
956038332 3:65119699-65119721 GTGTGGTGTGGGGGGATGGAGGG + Intergenic
956872368 3:73430669-73430691 GGGAGTTGGGGGTGTAAGGATGG - Intronic
956877800 3:73480588-73480610 GGGTGATGGGGTAGGCAGGAGGG - Intronic
956991674 3:74773610-74773632 ATGTCATGGGAGAGGAAGGAAGG - Intergenic
957078777 3:75620309-75620331 GTGGGTGGGGGGAGGGAGGGAGG - Intergenic
957244294 3:77698115-77698137 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
957381459 3:79435063-79435085 TGGGGTTGGGGGAGGAGGGAGGG + Intronic
957389949 3:79551328-79551350 GTGGGGTGGGGGAGGGGGGAAGG - Intronic
957494006 3:80966899-80966921 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
957720965 3:83999437-83999459 GTGGGGTGGGGGAGGTGGGAGGG - Intergenic
957878844 3:86183978-86184000 GTGTGCTGGTGGAGGAAAGGTGG - Intergenic
958061882 3:88494420-88494442 GTGGGTTGGGGGAGTGGGGAGGG - Intergenic
958607357 3:96376155-96376177 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
958825786 3:99028729-99028751 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
959080571 3:101796478-101796500 GTCAGTTGGGCGAGGAAGAAAGG + Intronic
959625394 3:108443997-108444019 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
959837850 3:110942079-110942101 ATGTGTAGGGAGAGGAAGGTAGG + Intergenic
960043387 3:113173210-113173232 GTAAGTAGGGGAAGGAAGGAAGG + Intergenic
960051372 3:113241955-113241977 GGAGGTTGAGGGAGGAAGGAAGG + Intronic
960079874 3:113530057-113530079 GAGAGCTGGGGGAGGAAGGTGGG + Intergenic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960826857 3:121796248-121796270 ATGGGTTGGGGGAGGCTGGAAGG - Intronic
961048002 3:123722505-123722527 GTGTGGTGGAGGAGGAAGACGGG + Intronic
961138772 3:124537602-124537624 GTGGTTTGGGAAAGGAAGGAAGG + Intronic
961419108 3:126785969-126785991 GTGGGGTGGGGGAAGAGGGAAGG - Intronic
961526109 3:127498689-127498711 GTGTCTTGGGGGAGAAAGGTAGG - Intergenic
961737480 3:129011056-129011078 GTGTGATGGGGGAGGCAGCGTGG + Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962287114 3:134095930-134095952 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
962329006 3:134461088-134461110 GTGTGTGTGGGAGGGAAGGAAGG - Intergenic
962403918 3:135083958-135083980 GTGTGTTTGTGGTGGCAGGATGG + Intronic
962756393 3:138468254-138468276 GTGTGCAGGTGGAGGAAGGGTGG + Intronic
963063151 3:141241317-141241339 GTGTGTAGGGGAAGGGAGGGAGG - Intronic
963178225 3:142324237-142324259 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
963216919 3:142758817-142758839 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
963276549 3:143337256-143337278 GAGGGTGGGGGGTGGAAGGAGGG - Intronic
963350904 3:144149897-144149919 GTGTGTTGTGGGGGGCAGGGGGG - Intergenic
963679307 3:148353245-148353267 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
963742938 3:149097892-149097914 GAGAGGTGGGGGAGGGAGGAGGG + Intergenic
963979784 3:151524627-151524649 GAGTGTGGAGGGTGGAAGGAGGG + Intergenic
964185219 3:153934255-153934277 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964485965 3:157185670-157185692 TAGTGGTGGGGGTGGAAGGAGGG - Intergenic
964492841 3:157255361-157255383 GGGAGTTGAGGGTGGAAGGAAGG + Intergenic
964500789 3:157346028-157346050 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
964570569 3:158105035-158105057 GTGTGTTGGGGGCGGGGGGGGGG - Intronic
964700505 3:159560672-159560694 GAGTGATGGGGGAGAATGGAAGG - Intronic
964727768 3:159832550-159832572 GTGTGTTAGGGGTGGAAGCTGGG - Intronic
964896559 3:161603609-161603631 GGGGGATGGGGGAGGGAGGAGGG - Intergenic
964949082 3:162265097-162265119 GTGAGCAGGGGGTGGAAGGAGGG - Intergenic
965177981 3:165361089-165361111 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
965419212 3:168436402-168436424 GTGTGTTGAGGGAGGAAGGAGGG - Intergenic
965486010 3:169279359-169279381 TTGTGTAGTGGGGGGAAGGAGGG - Intronic
965600224 3:170447036-170447058 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
965855266 3:173080500-173080522 GTGTGATGGCGGAGAGAGGAAGG + Intronic
966068364 3:175843794-175843816 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
966226221 3:177600945-177600967 GTGTTGTTGGGGTGGAAGGAGGG + Intergenic
966228134 3:177620164-177620186 GTGTTTAGGGGGTGGAAGTAAGG - Intergenic
966332629 3:178831748-178831770 GAGTGTGGAGGGAGGAAGGAGGG + Intronic
966482356 3:180425050-180425072 GTGGGGTGGAGGAGGAGGGAGGG - Intergenic
966638511 3:182162121-182162143 GTATGTTGGGGGTGGTAGGTGGG + Intergenic
966661564 3:182420213-182420235 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
966743994 3:183258439-183258461 GTGGGTTTGGGGAGGAAAGGAGG - Intronic
967019104 3:185506910-185506932 GTGAGAAGGAGGAGGAAGGATGG + Exonic
967203938 3:187102107-187102129 GTGTGGTGGGGGAGGAGAAATGG + Intergenic
967276469 3:187780326-187780348 GTGTGTAGGGGGCAGAAGGTTGG - Intergenic
967572129 3:191042303-191042325 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
968351181 3:198054030-198054052 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
968620636 4:1601992-1602014 GTGGGCCGGGGGAGGTAGGACGG + Intergenic
968673257 4:1863641-1863663 GGGCTATGGGGGAGGAAGGAGGG + Intergenic
968887300 4:3341532-3341554 GGGTGTGGGGGGAGGGAGGGTGG + Intronic
969122357 4:4919639-4919661 GTGTGTGGGGGTAGGGAGGTGGG + Intergenic
969136603 4:5034287-5034309 GTGTGTTTGGTGAGAAAGGCAGG - Intergenic
969162533 4:5273841-5273863 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
969168909 4:5343091-5343113 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
969355122 4:6620653-6620675 GTTGGTGGTGGGAGGAAGGAAGG + Intronic
969367391 4:6705165-6705187 GTGGCTTGGAGTAGGAAGGAAGG + Intergenic
969450784 4:7271839-7271861 GTGTTTGGGGGCAGGAAGGATGG + Intronic
969456623 4:7303877-7303899 GAGTGTGGGGAGAGAAAGGATGG + Intronic
969467520 4:7366476-7366498 GAGTGTTGGGGGAGAGAGGGGGG - Intronic
969581329 4:8067285-8067307 GTGCGTTGGGTGTGGGAGGAGGG - Intronic
969581846 4:8070535-8070557 CTGTCTTGGGGCAGGAAGCACGG - Intronic
969682636 4:8651872-8651894 GAGAGTTGGGAGAGGAGGGAGGG + Intergenic
969866808 4:10081660-10081682 GGGTGGGGGGGGGGGAAGGAGGG + Intronic
970015044 4:11503855-11503877 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
970041180 4:11798589-11798611 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
970137888 4:12945878-12945900 GGGAGTTAGGGAAGGAAGGAGGG + Intergenic
970466285 4:16326255-16326277 GTGTGTTAGTGGACAAAGGATGG - Intergenic
970510599 4:16777968-16777990 GAGGGATGGGGGAGGAAGGCAGG - Intronic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
970782750 4:19758543-19758565 GTGTGTTGGTGGGGGGAGGGAGG + Intergenic
970821444 4:20219989-20220011 GTGTTTAGGGGCAGGAAGCATGG + Intergenic
970928630 4:21483077-21483099 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
970948220 4:21720672-21720694 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
971495901 4:27264959-27264981 GTGAGTTTGGGGAGGCAGGCAGG + Intergenic
971880100 4:32360704-32360726 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
971904644 4:32710687-32710709 GGGGGTTGGGGGAGGGAGGAGGG + Intergenic
972223765 4:36987954-36987976 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
973786172 4:54334887-54334909 GTGTGGTGTGGAAGGAAGGTAGG - Intergenic
974080116 4:57203390-57203412 GTGTGGTGGGTGAGGAAGTCAGG + Intergenic
974459359 4:62167229-62167251 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
974667974 4:64990373-64990395 GTGATTTGGGGGCGGAATGATGG - Intergenic
974683722 4:65196221-65196243 AGAAGTTGGGGGAGGAAGGAGGG - Intergenic
974719712 4:65722495-65722517 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
975055758 4:69927290-69927312 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
975244360 4:72102517-72102539 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
975312456 4:72917941-72917963 GTGTGTTGGGGGATGTGGCATGG - Intergenic
975337685 4:73199251-73199273 GTGTGTGTTGGGAGGAGGGAAGG + Intronic
975435760 4:74349351-74349373 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
975606186 4:76156640-76156662 TTGGGTTGTGGGAGGAAGGTGGG - Intergenic
975757282 4:77583339-77583361 CTGTGTTGGGAGATGAAGGATGG - Intronic
975944201 4:79684936-79684958 GTGTGTTGGGGGTGGAGGGGTGG - Intergenic
976026488 4:80693546-80693568 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
976173402 4:82327773-82327795 GTTTGTTTAGGCAGGAAGGATGG + Intergenic
976258648 4:83124869-83124891 GGGTGTGGGGGGAGGAGGGGAGG + Intronic
976339961 4:83935731-83935753 CTGTGATGAGGAAGGAAGGAGGG + Intergenic
976482567 4:85561923-85561945 ATGTGGTGAGGGATGAAGGATGG + Intronic
976688108 4:87838339-87838361 GTGTGGTGGGGGAGTAGGGAGGG - Intronic
976890905 4:90046510-90046532 CTGAGTCGGGGGAGTAAGGAGGG - Intergenic
977047857 4:92090142-92090164 GTGTGTTGGGGGGGGGGGGGGGG - Intergenic
977154111 4:93552021-93552043 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
977158771 4:93608452-93608474 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
977469704 4:97427707-97427729 TTGTGTGGGGGGAGGGGGGAGGG - Intronic
977493456 4:97742214-97742236 TGGGGTTGGGGGAGGAAGGAGGG + Intronic
977505707 4:97900772-97900794 GTGGGTGGAGGGTGGAAGGAAGG + Intronic
978285114 4:107068398-107068420 TTGTGTGGGGGGAAGAGGGAAGG - Intronic
978297266 4:107220509-107220531 GTTTGTTATGGAAGGAAGGAAGG + Intronic
978399423 4:108314911-108314933 TTGTGTCGGGGGAGGCAGGGTGG + Intergenic
978521213 4:109617410-109617432 GTGTGTCGGGGGTGGGAGGGAGG + Intronic
978590694 4:110321960-110321982 GTGGGGTGGGGGAGGTGGGAGGG - Intergenic
978705091 4:111698448-111698470 GAGGGAGGGGGGAGGAAGGAGGG + Intergenic
978733377 4:112057479-112057501 GTGTGATGGGGTAGGAAAGGGGG - Intergenic
978781004 4:112554194-112554216 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
978900118 4:113939053-113939075 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
979046040 4:115866477-115866499 GTGAGATGAGTGAGGAAGGAAGG + Intergenic
979335958 4:119463140-119463162 GTGGGGTGGGGGATGGAGGAGGG - Intergenic
979418946 4:120479336-120479358 GTGTGGTGGGGGAAGAGGGGAGG + Intergenic
979420222 4:120494808-120494830 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
979440000 4:120740449-120740471 GTGGGTTTAGAGAGGAAGGAGGG - Intronic
979615104 4:122733360-122733382 GTGTGTTGGGGTTGGAGGGCGGG - Intronic
980034304 4:127865894-127865916 GTGGGGTGGGGGAAGAGGGAGGG + Intergenic
980112472 4:128647898-128647920 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
980884999 4:138752640-138752662 CTGGGGTGGAGGAGGAAGGAAGG - Intergenic
981028431 4:140099744-140099766 GTGTGTTGGGGAAGGGAGGTTGG - Intronic
981249700 4:142585062-142585084 TGGTGGTGGGGGAGGAATGAAGG + Intronic
981375123 4:144006330-144006352 ATGTGTTGGGGGAGAGAGCATGG + Intronic
981591504 4:146368638-146368660 GTTTGTTCAGGAAGGAAGGAAGG - Intronic
981643796 4:146974978-146975000 ATGTGGTGGGGAAGGGAGGAGGG - Intergenic
981688746 4:147482699-147482721 CATTGTTGGAGGAGGAAGGAAGG + Intronic
981837986 4:149077831-149077853 GGGGGTGGGGGGAGGAGGGAGGG - Intergenic
981863833 4:149389707-149389729 GTGGGTTGGGGGCGGGGGGAGGG + Intergenic
981953722 4:150444342-150444364 GAGTGGTGGGGGAGGAAGGCAGG - Intronic
982000228 4:151015385-151015407 GTGTGTGGTGGCAGGAAGGGAGG + Intronic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982181307 4:152751011-152751033 GTGAGTGGGGGGAGGGAGGAGGG + Intronic
982331979 4:154191231-154191253 ATGTGTGGGGGCAGGAAAGATGG - Intergenic
983302298 4:165942297-165942319 GAGTCTTGGCGGAGGATGGAGGG - Intronic
983950796 4:173639048-173639070 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
984050314 4:174857357-174857379 GTGTGTTGGGGGTGGGGGGGGGG + Intronic
984374509 4:178910610-178910632 GAGGGTTGAGGGTGGAAGGAGGG - Intergenic
984943756 4:184955328-184955350 GTGTGTGGAGGGAGGAGGGCAGG + Intergenic
985783979 5:1884822-1884844 GTGGGAGAGGGGAGGAAGGAGGG - Intronic
985865892 5:2514088-2514110 GTGTGTTTGGGAAAGAAGAAAGG - Intergenic
985930510 5:3053275-3053297 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
985963200 5:3319412-3319434 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986087940 5:4470904-4470926 GTGGGGTGGGGGAGGGGGGATGG + Intergenic
986139342 5:5015387-5015409 GAGTGTTGGGTGAGGAGGAAGGG - Intergenic
986195396 5:5533190-5533212 GTGTGTTGAGGGATGAAGTGTGG + Intergenic
986286684 5:6364315-6364337 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
986365964 5:7032012-7032034 GTGTGGTGGGGGAAGAAGCAAGG - Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
986736842 5:10674357-10674379 GAGTGTTGGCGGAGCAGGGATGG - Intergenic
986859094 5:11904777-11904799 GTGGGTTGGGGGAGGGAGGCTGG + Intergenic
986891966 5:12320299-12320321 GTGTGCTGGTGGGGCAAGGAAGG + Intergenic
987059667 5:14230370-14230392 GTGTGTTGGGTGATGAGGGGAGG + Intronic
987099558 5:14580251-14580273 TTGTCTTGTGGGAGGAGGGAAGG + Intergenic
987173318 5:15281471-15281493 GTGAGTGGGGGGTGGGAGGAGGG + Intergenic
987699404 5:21376531-21376553 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
987973109 5:24976847-24976869 GTGGGTTGGGGGAGTGGGGAGGG - Intergenic
988320210 5:29685427-29685449 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
988491350 5:31708073-31708095 CTAGGTTGGGGGAGGCAGGAAGG + Intronic
988971914 5:36477051-36477073 GTGGGGTGGGGGAGGGGGGACGG + Intergenic
989147401 5:38262233-38262255 CTGTGGTGGGGCAGGAAGAAGGG + Intronic
989560214 5:42841897-42841919 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
989701004 5:44264925-44264947 GTGTGTTGGGGGTGGGGGGGTGG - Intergenic
989785181 5:45318413-45318435 GTGGGGTGGGGGAGGGAGGAAGG + Intronic
990062524 5:51669808-51669830 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
990151271 5:52820372-52820394 GTGGGTGGGGGGAGGGGGGAGGG + Intronic
990396961 5:55391964-55391986 GTTTGTAGTGGGAGAAAGGAAGG - Intronic
990634701 5:57711588-57711610 GTGTGCAGGGCCAGGAAGGAGGG - Intergenic
991082488 5:62616054-62616076 GGGAGGTGGGGGAGGAAGGGGGG + Intronic
991088488 5:62670845-62670867 GGATGTTGGGGGTGGAGGGAGGG - Intergenic
991125607 5:63066293-63066315 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
991127875 5:63088064-63088086 GTGTGTTGGGCTAGGGAAGAGGG + Intergenic
991171100 5:63626737-63626759 GTGGGGTGGGGGAGGGCGGAGGG - Intergenic
991533415 5:67639585-67639607 ATGTGTGGGAGGAGGAAGAAAGG - Intergenic
991559116 5:67930390-67930412 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
991680519 5:69134881-69134903 GTGGGTTGGGGGAAGAGGGGAGG + Intergenic
991937344 5:71815261-71815283 GTGAGGTGGGGGATGGAGGAAGG + Intergenic
992023591 5:72649510-72649532 GTGTGTGGGGGCAGGAAAGAGGG - Intergenic
992142042 5:73808250-73808272 GGGGGTTGGGGGAGGTAGGGAGG + Intronic
992236282 5:74712280-74712302 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
992553316 5:77880024-77880046 GTCTGTTGGGGGAAGAAAGTTGG - Intergenic
992577144 5:78125992-78126014 GTGGGTGGGGGCAGCAAGGAGGG + Intronic
992720617 5:79557317-79557339 GTATGTGGTGGAAGGAAGGAAGG - Intergenic
993022860 5:82612582-82612604 GTGTGTAGGGGGTGGGAGGGTGG + Intergenic
993204216 5:84859994-84860016 GTGTTTTGGGGGTGGAGGCAAGG + Intergenic
993611484 5:90059779-90059801 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
993613164 5:90079075-90079097 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
993999909 5:94766522-94766544 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
994477443 5:100289072-100289094 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
994525419 5:100900772-100900794 GTGGGGTGGGGGTGGAAGGAGGG + Intronic
994535263 5:101022311-101022333 CGGGGTTGGGGGAGGCAGGAGGG + Intergenic
994802169 5:104392618-104392640 GTGTGTTGGGGGTGGCAGTGCGG + Intergenic
994843631 5:104957241-104957263 GAGAGTTGGGTGAGGAAGAAAGG - Intergenic
995144899 5:108776194-108776216 ATATGTTGGGGGAAGAATGAAGG + Intronic
995198362 5:109398627-109398649 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
995426779 5:112032728-112032750 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
995891893 5:116963259-116963281 TTCTGTTTGGGGAGAAAGGAGGG - Intergenic
995951672 5:117721581-117721603 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
996107528 5:119522077-119522099 GTGGGGTGGGGGAGGAGGGAGGG - Intronic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996213969 5:120845179-120845201 GTGTGTATGGGGAGGAAGAAGGG + Intergenic
996308670 5:122078420-122078442 GTGTCTGGGGGGAGGAGGGCAGG - Intergenic
996746852 5:126853384-126853406 GGGTGTTGGGGGTGGGGGGAGGG + Intergenic
996772835 5:127103242-127103264 GTGGGGTGGGGGAGGTGGGAGGG - Intergenic
996789426 5:127276868-127276890 GTGTGTTGGGGAAGGGGTGATGG + Intergenic
996936374 5:128953334-128953356 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
996954240 5:129164245-129164267 GTGTGCTGGTGGGGCAAGGAAGG + Intergenic
997049230 5:130358913-130358935 GAGGGTTGGGGGTGGGAGGAAGG + Intergenic
997087981 5:130823600-130823622 GTGGGTTGGGGGAGGGGGGAGGG + Intergenic
997200564 5:132007613-132007635 CAGTGTTGTGGGAGGATGGAAGG + Intronic
997530894 5:134580455-134580477 GTGGGGTGGGGAAGGCAGGACGG - Exonic
997582548 5:135026934-135026956 CTGCAGTGGGGGAGGAAGGAGGG - Intergenic
997735984 5:136212997-136213019 ATGTGTTGGGGGTGGCAGGGAGG + Intergenic
997876265 5:137550371-137550393 GTGGGGTGGGGGAAGGAGGAGGG + Intronic
998011993 5:138702858-138702880 GTGTTCTGAGGGAGTAAGGAGGG + Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
998592219 5:143489801-143489823 GTGAGTGGGGAGAGGAAGGGAGG + Intergenic
998670239 5:144345204-144345226 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
998716095 5:144886231-144886253 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
998720029 5:144934244-144934266 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
998954105 5:147420733-147420755 GTGTGTTGGTGGTGGAGAGAAGG - Intronic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999123849 5:149231414-149231436 GTGTGTTGGGGGATGGGGAATGG + Intronic
999195343 5:149777996-149778018 GTCTGTGGGGGGGGGAAGGGGGG - Intronic
999349624 5:150857072-150857094 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
999382583 5:151131861-151131883 GGGTGTGGGGGCAGGAAGGATGG - Intronic
999389277 5:151178407-151178429 GAGTGTTGGGGCAGGGAGGTGGG + Intergenic
999449702 5:151668780-151668802 GAGGGTTGGGGGAAGAAGCATGG - Intronic
999484574 5:151983115-151983137 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
999491465 5:152055501-152055523 GAGTGTTGGGGCAGGGAGGTGGG + Intergenic
999541013 5:152572606-152572628 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
999740316 5:154545207-154545229 GTCTATTGCTGGAGGAAGGATGG - Intergenic
999745311 5:154587469-154587491 GTGTGTTGGGGGGGGAGGTGAGG - Intergenic
999793387 5:154964730-154964752 GTGTTTTGGGGGAGATAGAAGGG + Intronic
999918181 5:156286673-156286695 GTGGGTTGGGGGAGTGGGGAGGG + Intronic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000255828 5:159537365-159537387 GTGTGTCGGTGGATGATGGAGGG + Intergenic
1000271031 5:159683414-159683436 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1000275331 5:159729177-159729199 GTGCGGTGGAGTAGGAAGGATGG + Intergenic
1000326382 5:160175660-160175682 GTCGATTGGGGGAGGAAGGGAGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1000746478 5:165040527-165040549 TGGGGTTGGGGGAGGAGGGATGG - Intergenic
1000929661 5:167236009-167236031 TTGTGAGGTGGGAGGAAGGAAGG - Intergenic
1000983333 5:167840533-167840555 GGGGGCTGGGGGAGGAAGGAGGG - Intronic
1001025903 5:168224343-168224365 AGGTGTTGGGGGAGAGAGGAGGG - Intronic
1001398888 5:171435146-171435168 GAGTGGTGGGAGAGGAAGGTGGG + Intronic
1001410720 5:171509448-171509470 TTGTGTAGGGGGAGCAGGGAGGG - Intergenic
1001552168 5:172610988-172611010 CTGTGCTTGGGGAGAAAGGATGG + Intergenic
1001868980 5:175133897-175133919 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1001906252 5:175476024-175476046 GTGTGGTGGGGAAGGGAGGCGGG + Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002198645 5:177514531-177514553 GTTAGTTGGGGGAGGACAGAGGG - Intronic
1002278132 5:178116146-178116168 ATTTGGTGGGGGAGGAGGGAGGG - Intronic
1002466748 5:179412211-179412233 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466837 5:179412416-179412438 GTCGGTTGGGGGAGGGAGGAAGG - Intergenic
1002466898 5:179412554-179412576 GTCGGTTGGGGGAGGGTGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002510973 5:179717369-179717391 GGGAGTTGGGGGAGGAAACAGGG - Intronic
1002816615 6:686877-686899 ATTTGTTGGGGGTGGATGGAGGG - Intronic
1002893788 6:1362107-1362129 GTGGGTGGGGGGAGGGGGGAGGG + Intergenic
1003157098 6:3606369-3606391 GTGCGTTGGGGGAGAAGGAAGGG - Intergenic
1003319017 6:5035773-5035795 GTGGGGGGGGGAAGGAAGGAAGG - Intergenic
1003319018 6:5035777-5035799 ATATGTGGGGGGGGGAAGGAAGG - Intergenic
1003336001 6:5172813-5172835 GTATTTTGGGGGAGAAAGGAAGG - Intronic
1003368088 6:5496146-5496168 TTTGGTTGGGGGTGGAAGGAGGG + Intronic
1003426728 6:6002861-6002883 AAGTGTTGGGAGACGAAGGAGGG - Intronic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1003953338 6:11139852-11139874 GGGGGTTAGAGGAGGAAGGAGGG + Intergenic
1004015939 6:11732007-11732029 GTGTTTTGGGGTAGGAGAGAAGG + Intronic
1004182647 6:13394405-13394427 GTGTCTGGCGGGGGGAAGGATGG + Intronic
1004339777 6:14798193-14798215 AAGGGTTGGGGGAGGGAGGAAGG + Intergenic
1004749732 6:18549488-18549510 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1004799695 6:19132699-19132721 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1004844476 6:19624335-19624357 TTGAGTGGGGGGAGGAGGGAGGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005047750 6:21658281-21658303 GTTTTTTTGGGGAGGAGGGACGG - Intergenic
1005168311 6:22951371-22951393 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1005959714 6:30686536-30686558 GGGTGTTGGGGAGGCAAGGAGGG + Exonic
1006002016 6:30972574-30972596 GGGTGGTGGGGGAGGAGAGATGG - Intergenic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006082714 6:31576673-31576695 TGGTCTTGGGGGAGGATGGATGG + Intronic
1006213162 6:32414532-32414554 GAGGGAGGGGGGAGGAAGGAGGG + Intergenic
1006592762 6:35170267-35170289 GTGAGTGGGGGCAGGAAGGCAGG + Intergenic
1006637297 6:35469564-35469586 GTGTGGTGGGGGCGGTAGAAAGG + Intronic
1006668739 6:35716596-35716618 ATGGGTTGGGGCAGGTAGGAAGG - Intronic
1006932378 6:37696100-37696122 GTGTGTGCGCGCAGGAAGGAAGG + Intronic
1007048832 6:38804903-38804925 GTGTGTTGGGGGTGGCCGGGGGG + Intronic
1007179969 6:39922919-39922941 GGGTGCTGGTGGAGGAAGGAGGG - Intronic
1007341878 6:41195853-41195875 GTGTGTTGATGCAGGAATGAGGG - Intronic
1007473857 6:42106688-42106710 GGGTGCTGGGGGAGGGAGGGGGG + Exonic
1007589096 6:43010797-43010819 GTTTGTTGGGGGAGGAATATGGG + Intronic
1007592036 6:43027709-43027731 GTGTGTTGGGGGGGGGGGGTTGG - Intronic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007859297 6:44890608-44890630 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1008078819 6:47173538-47173560 GTGGGATGGGGGAGGGGGGAGGG + Intergenic
1008153581 6:47987250-47987272 GTGGGTGGGGGGAGGGGGGAAGG + Intronic
1008184079 6:48368958-48368980 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1008240555 6:49105928-49105950 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1008354587 6:50537141-50537163 GTGAGGTGGGGGAAGAGGGAGGG - Intergenic
1008588458 6:52970191-52970213 TTGGGTTGGGGCAGGGAGGAGGG - Intergenic
1008786117 6:55170724-55170746 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1009320343 6:62280321-62280343 GTGTGTTGGTGTGGGAAGGAGGG + Intronic
1009430804 6:63563697-63563719 ATGTGTTGGGGAAGGAGGGAAGG + Intronic
1009656145 6:66546920-66546942 ATGTGTTGGGGGCAGAGGGAGGG + Intergenic
1009782641 6:68289894-68289916 GTGGCGTGGGGGAGGAGGGAGGG + Intergenic
1009904414 6:69850967-69850989 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1010108696 6:72198500-72198522 GTGTGTTGAGGGGAGAGGGATGG + Intronic
1010261396 6:73821158-73821180 TGGGGTTGGGGGAGGAGGGAGGG + Intronic
1010477309 6:76303878-76303900 GAGTGTGGAGGGAGGAGGGAAGG - Intergenic
1010597176 6:77778144-77778166 GGGTGGTGGGGTGGGAAGGAAGG + Intronic
1010680650 6:78794970-78794992 GTGGGATGGGGGAGGGGGGAGGG + Intergenic
1010975147 6:82303519-82303541 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1011093598 6:83633951-83633973 GTGGGTGGGGGGAGGGCGGAGGG + Intronic
1011161756 6:84398796-84398818 GTGTGTTGCAGGATGAATGACGG - Intergenic
1011247610 6:85336044-85336066 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
1011323685 6:86125621-86125643 GGGAGTTGGGGGGGGAAGAAAGG - Intergenic
1011587696 6:88944535-88944557 GGGGGTTGGGAGAGGAAGAAAGG - Intronic
1012154073 6:95794441-95794463 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1012167130 6:95971352-95971374 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1012251810 6:96988954-96988976 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1012481356 6:99670941-99670963 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
1012500129 6:99879236-99879258 GTGTGATGGGGGAGTGAGGCAGG - Intergenic
1012707658 6:102552363-102552385 GTGGGGTGGGGGAGGTGGGAGGG + Intergenic
1012818288 6:104052894-104052916 ATGAGTAGGGGGAGGAAGGAAGG + Intergenic
1012933845 6:105344679-105344701 GTGGGGTGGGGGAGGCGGGAGGG + Intronic
1013032830 6:106352353-106352375 GGGTGTTGGGGGAGAAAGGAGGG - Intergenic
1013388492 6:109657690-109657712 GGGGGTAGGGGGAGGCAGGAGGG - Intronic
1013473325 6:110485573-110485595 GTGGGGTGAGGGAGGAAGCAAGG - Intergenic
1014040800 6:116822710-116822732 GTGGGTTGGGGGAGGGGGGAGGG + Intronic
1014082204 6:117300668-117300690 GTGTGTGGGGGGAGAAGAGAAGG + Intronic
1014485644 6:121996099-121996121 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1014856789 6:126411977-126411999 GGGAGTGGGGGAAGGAAGGAAGG - Intergenic
1015145997 6:129987818-129987840 GTGGGATGGGGGAGGAAGAGAGG - Intergenic
1015192867 6:130490659-130490681 GAGGGTAGGGGGTGGAAGGAAGG - Intergenic
1015258108 6:131202609-131202631 GTGGGATGGGGGAGGGGGGAGGG + Intronic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015470888 6:133604947-133604969 GAGGGTTGAGGGTGGAAGGAGGG - Intergenic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015645204 6:135379920-135379942 GGGAGTTGGGGGAGGGAGGGAGG - Intronic
1015688838 6:135897294-135897316 GTGTGTAGGCGGAGGAAGGAGGG + Intronic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1016186703 6:141206315-141206337 GTGGGATGGGGGAGGGGGGAGGG + Intergenic
1016222200 6:141688617-141688639 ATGGGGTGGGGAAGGAAGGAAGG + Intergenic
1016294439 6:142559846-142559868 TTGTGTGGGGGGAGGGGGGAGGG - Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016341210 6:143062986-143063008 CTGTGTTGTGGGAGCAAGGCAGG + Intronic
1016370685 6:143371297-143371319 GTGTGTTGGGGGGCGGGGGAGGG - Intergenic
1016440932 6:144082625-144082647 GGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1016831407 6:148436892-148436914 GTATGTTAGGGGAGGAGAGAAGG + Intronic
1016969480 6:149749310-149749332 CTGGGTTGGGCGAGGTAGGACGG + Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017561045 6:155628172-155628194 GTGTGTTTGGGGAGCAGGGATGG - Intergenic
1017570816 6:155742361-155742383 GGGTGTTGAGGGAAGAGGGATGG - Intergenic
1017688057 6:156933282-156933304 GTGTGTTGGAGGAGGAGGCGGGG + Intronic
1017720593 6:157240828-157240850 GTGTTTTGGGGGAGGGCTGATGG + Intergenic
1017726476 6:157279560-157279582 GAGAGTGGGGGAAGGAAGGAAGG + Intergenic
1017757722 6:157543792-157543814 GTGTCCTGAGGTAGGAAGGAGGG + Intronic
1017817766 6:158027773-158027795 GTGTCTTGGGAGAGCAAGGAAGG + Intronic
1017831253 6:158132019-158132041 GTGTGTTGGGGTAGGAGAGATGG + Intronic
1018073439 6:160187374-160187396 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1018300385 6:162396342-162396364 ATGTGGTGGGGCAGCAAGGAGGG - Intronic
1018323037 6:162633737-162633759 ATGAGGTGGGGGAGGAAGGGAGG + Intronic
1018549986 6:164984828-164984850 GGGTGTTGGGGGTGGGAGAAAGG - Intergenic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018606976 6:165608252-165608274 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1018673832 6:166201988-166202010 GTGGGTGGAGGAAGGAAGGAAGG + Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1018953277 6:168392352-168392374 GTGTGCTGGGGCATGAGGGATGG - Intergenic
1019167928 6:170111192-170111214 GTGGGGTGGTGGAGGAAGCAGGG - Intergenic
1019197557 6:170291158-170291180 GTGTGGTGAGGGAGGAAGGGGGG - Intergenic
1019299608 7:296501-296523 CTGTGCTCGGGGAGGATGGAGGG - Intergenic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019401886 7:859487-859509 GTGTGTGTGGGGAGGAGTGAGGG + Intronic
1019599406 7:1873796-1873818 GTGTGTTTGGGGAGCAGGCAGGG + Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1020035298 7:4959995-4960017 GGGTGTTGGGGGGGGAGTGAGGG + Intergenic
1020247116 7:6438202-6438224 GTTGGGTGGGGGAGGAGGGAGGG + Intronic
1020717058 7:11688051-11688073 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1020878893 7:13733959-13733981 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1020927286 7:14347107-14347129 GTTTGTTAAGGGAGGCAGGAAGG + Intronic
1021402875 7:20229866-20229888 TTCAGTTGGGAGAGGAAGGATGG - Intergenic
1021496875 7:21284594-21284616 GTGTGTTGGAGGATGAGGGGCGG + Intergenic
1021766359 7:23953157-23953179 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1021771026 7:24001564-24001586 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1021813420 7:24425349-24425371 GTGTGATGGGGGAGGAGAAAAGG - Intergenic
1021943571 7:25703639-25703661 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1021962339 7:25885379-25885401 GAGTGGTGGGGGAAGAAGGGAGG - Intergenic
1022104824 7:27190111-27190133 AAGTGTTGGGGAAGAAAGGAGGG - Intergenic
1022174929 7:27863580-27863602 CAGTGCTGGGGGAAGAAGGATGG - Intronic
1022473378 7:30695016-30695038 AGGAGGTGGGGGAGGAAGGAAGG + Intronic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022522413 7:31016738-31016760 GAGTGTTGGGGGAGGAACAGCGG - Intergenic
1022526786 7:31043163-31043185 GAATGCTGGGGGAGGAAGGGAGG - Intergenic
1022546338 7:31192804-31192826 GTGTGGTGGGGGAGGAGGTGGGG - Intergenic
1022929803 7:35098812-35098834 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1022937753 7:35197779-35197801 GTGTGCTGGGGGTGGGGGGAAGG - Intergenic
1023278995 7:38550681-38550703 GAGTGGTGGGAGAGGGAGGAGGG - Intronic
1023303539 7:38799005-38799027 GTGTAATGGGGCAGGAACGAAGG + Intronic
1023618013 7:42040618-42040640 GTGTGTTGGGGTGGGGAGGGTGG - Intronic
1023789048 7:43737531-43737553 GGGGGTTGGGGGAGGAAAGGGGG - Intergenic
1024104173 7:46065118-46065140 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1024167253 7:46747253-46747275 GTGTCTAGAGGGAGGAAGGAGGG - Intronic
1024480666 7:49858554-49858576 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1024593576 7:50912794-50912816 GTGTTTGGGTGGGGGAAGGAAGG + Intergenic
1024788076 7:52931227-52931249 GTGGGGTGGGGGAGGAGGGAGGG + Intergenic
1024877351 7:54041438-54041460 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1024893546 7:54230271-54230293 TGGAGTTGGGGGAGGAGGGAGGG - Intergenic
1024900372 7:54312116-54312138 TGGAGTTGGGGGAGGAGGGAGGG + Intergenic
1025315587 7:58022369-58022391 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1025609612 7:63066867-63066889 GAGGGATGGGGGAGGAAGGCAGG + Intergenic
1025907466 7:65798922-65798944 ATGTGTTGGGGATGGAAGAAGGG + Intergenic
1026174442 7:67983826-67983848 GCACTTTGGGGGAGGAAGGAGGG + Intergenic
1026204679 7:68246509-68246531 TGGTGTTGTGGGAGGAAGGCAGG + Intergenic
1026451777 7:70535799-70535821 GTCTTTTGGTGGAGGAAAGAAGG - Intronic
1026525499 7:71149976-71149998 GTGTGTCGGGGGCTGGAGGAGGG + Intronic
1026531992 7:71207565-71207587 GTGGGTTGGGGTAGGGAGGTAGG + Intronic
1027229692 7:76265050-76265072 TTGTGGGGTGGGAGGAAGGAGGG - Intronic
1027519548 7:79188276-79188298 GTCTGTTGGGGGAGGCGGGGTGG - Intronic
1027557386 7:79682796-79682818 GTGTGTGGTGTGTGGAAGGAAGG + Intergenic
1027605567 7:80294307-80294329 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1027792841 7:82654833-82654855 GTGGGGTGGGGGAGGTGGGAGGG + Intergenic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1028244382 7:88459405-88459427 GTGAGATGAGGGAGGCAGGAGGG - Intergenic
1028643224 7:93067638-93067660 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1028647492 7:93114299-93114321 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1028821319 7:95215112-95215134 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1028886989 7:95944873-95944895 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1028986503 7:97013283-97013305 GTGTGTTGGGGCGGGGGGGAGGG - Intergenic
1029026974 7:97427150-97427172 GTATGTGGGGGGATCAAGGAGGG - Intergenic
1029412968 7:100427184-100427206 GAGGGAAGGGGGAGGAAGGAAGG - Intronic
1029412979 7:100427210-100427232 GAGGGAAGGGGGAGGAAGGAAGG - Intronic
1029412990 7:100427236-100427258 GAGGGAAGGGGGAGGAAGGAAGG - Intronic
1029730696 7:102436019-102436041 GTGTGATGGAGGAGGGAGGACGG + Intronic
1029746946 7:102521286-102521308 GTCTGATGGGTGAGGACGGAAGG - Intergenic
1029764899 7:102620375-102620397 GTCTGATGGGTGAGGACGGAAGG - Intronic
1029985662 7:104921012-104921034 GTGGGGTGGGGGAGGGAAGATGG - Intergenic
1030467266 7:109919181-109919203 GTGGGGTGGGGGAGGCGGGAGGG - Intergenic
1030525936 7:110655274-110655296 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1031069758 7:117149315-117149337 GTGTTTAGGGGTAGGAAGGTCGG - Intronic
1031148523 7:118025575-118025597 TTCTGCTGGGGGAGGAAGTAAGG + Intergenic
1031202763 7:118710659-118710681 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1031383210 7:121113647-121113669 GAGGGATGGGGAAGGAAGGAAGG + Intronic
1031481046 7:122279055-122279077 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1031560890 7:123236755-123236777 GAGAGGTGGGGGAGGAAGGAAGG - Intergenic
1031784245 7:126008897-126008919 GTGTGTTGGGGGCAAGAGGAGGG - Intergenic
1031808893 7:126341201-126341223 GTGTGCTGTGGGAGGGAGGAGGG - Intergenic
1032083694 7:128872819-128872841 TGGTGATGGGGGAGGAGGGAGGG - Intronic
1032331754 7:130987023-130987045 GTGTGTTGGGGGTGGGAGGTGGG + Intergenic
1032575997 7:133055793-133055815 GTATGGTGGGGGAGGAGTGAGGG - Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1032951903 7:136924353-136924375 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1033022651 7:137742225-137742247 GGGGGTTGGGGGTGGAAGGAGGG - Intronic
1033071367 7:138206435-138206457 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1033143313 7:138847380-138847402 GTGTGGTAGGGGAGGAAGGGCGG + Intronic
1033356889 7:140607381-140607403 ATGAGCTGGGGGAGCAAGGAAGG + Intronic
1033409584 7:141105095-141105117 GTGAGGTGGGAGAGGAAAGAGGG + Intronic
1033530313 7:142256429-142256451 GTGTGTTGGGGGAGAAGGAGGGG + Intronic
1033542392 7:142369031-142369053 GTGTGTGGGGGAGGGAGGGAAGG + Intergenic
1033722741 7:144078846-144078868 GTATCTTGTGGGAGGAGGGAAGG - Intergenic
1033789526 7:144774964-144774986 GGGCGGTGGGGGAGAAAGGAGGG + Intronic
1033815637 7:145069400-145069422 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1034065811 7:148135879-148135901 GAGGGATGGGGAAGGAAGGAGGG + Intronic
1034516091 7:151580809-151580831 GTGGGTGCGGGGAGGAAGTAGGG + Intronic
1034523703 7:151640671-151640693 GTGAATCGGGGAAGGAAGGAAGG - Intronic
1034561364 7:151881508-151881530 ATGTGTTGTGGGAGGAATCATGG - Intergenic
1034899016 7:154896063-154896085 GTGGGTTGGGTCAGGCAGGAGGG - Intergenic
1035162260 7:156959785-156959807 GTGTGTTGAAGGAGAAAGGAAGG + Intronic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035413610 7:158666253-158666275 GTGTGTTGGGACAGGCAGAAGGG - Intronic
1035659762 8:1338470-1338492 GGGTCTGGGGGCAGGAAGGAAGG + Intergenic
1035792246 8:2317825-2317847 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1035800559 8:2403880-2403902 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1035924007 8:3708084-3708106 GTGTGTGGGGTGTGCAAGGACGG + Intronic
1036740811 8:11359786-11359808 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1037062542 8:14532706-14532728 GTGTGTGGGGGGAGGGCGGGGGG + Intronic
1037128821 8:15383552-15383574 GAGTGTTTGGGGAAGAAGGAAGG - Intergenic
1037169413 8:15873908-15873930 GAGTGGGGAGGGAGGAAGGAAGG - Intergenic
1037504311 8:19515287-19515309 GTCTTTTGGGTGAGGAAGGAAGG - Intronic
1037669515 8:21002154-21002176 TTGTTTTGGGGGAGGAGGGTGGG - Intergenic
1037797056 8:22004955-22004977 GTGGGTTGGGGGAGGAGAGTGGG - Intronic
1037809316 8:22077203-22077225 GGGAGGTGGGGGAGGTAGGAGGG + Intronic
1037997008 8:23359982-23360004 GTGTGTGTGAGCAGGAAGGAGGG - Intronic
1038588765 8:28816294-28816316 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1038770596 8:30475725-30475747 GTGTTGGGGAGGAGGAAGGAGGG + Intronic
1038786476 8:30622114-30622136 GTGGGTGGGGGGAGGGGGGAGGG - Intronic
1039245088 8:35599943-35599965 TGGGGTTGGGGGAGGAGGGAGGG - Intronic
1039412775 8:37369403-37369425 TTGACTTGGGGCAGGAAGGAAGG - Intergenic
1039434976 8:37553745-37553767 GTCTGTTGCGGGAGGCTGGAGGG + Intergenic
1040018531 8:42720020-42720042 AGGTGCTGGGGCAGGAAGGAAGG - Intronic
1040357521 8:46633834-46633856 GTGTGGTGGGGGAAGAGGGGAGG + Intergenic
1040612660 8:49000851-49000873 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1040655808 8:49506242-49506264 TTGGGTTGGGGGAGGGGGGAAGG + Intergenic
1041169583 8:55127722-55127744 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1041293068 8:56325781-56325803 GTGAGTGAGGGCAGGAAGGAGGG - Intergenic
1041318913 8:56593716-56593738 GTGGGCTGGAGGAGGCAGGAGGG + Intergenic
1041329850 8:56713275-56713297 GTCTGTGGGGGGAGCAAGAAGGG - Intergenic
1041340071 8:56835619-56835641 GTTTGTGGGGGGAAGGAGGAAGG - Intergenic
1041381270 8:57256644-57256666 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1041585004 8:59506247-59506269 GTGTTTTGAGGGAGGAAGAATGG + Intergenic
1041673837 8:60517689-60517711 GCGTGCTGGTGGAGGAAGGTTGG - Intronic
1041723548 8:60997968-60997990 GTGTGTTTGTGGAGGACGGTGGG + Intergenic
1041956886 8:63566136-63566158 GGAAGTTGGGGGAGGAGGGAGGG - Intergenic
1042014217 8:64289546-64289568 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1042027324 8:64437981-64438003 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1042203413 8:66304071-66304093 GTGTGTTATGGCAGGAGGGAGGG - Intergenic
1042338869 8:67657985-67658007 GTGGGATGGGTGAGGAAGGCAGG - Intronic
1042498307 8:69480887-69480909 GTGGGATGGGGGAGGGGGGAGGG + Intronic
1042540159 8:69900015-69900037 GTCGGCTGTGGGAGGAAGGAGGG + Intergenic
1042609858 8:70586272-70586294 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042801106 8:72718663-72718685 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043070880 8:75634589-75634611 TGGTGTGGGGGGAGGCAGGAGGG - Intergenic
1043201029 8:77369500-77369522 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043202068 8:77382846-77382868 GTGGGTGGGGGGAGGGGGGAGGG - Intergenic
1043258862 8:78171964-78171986 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1043403672 8:79908794-79908816 CTGTCTTGGGGCAGGAGGGAAGG + Intergenic
1043827462 8:84946721-84946743 GTGGGATGGGGAAGGGAGGAGGG - Intergenic
1043874056 8:85464539-85464561 GTGGGGTGGGGGTGGAAGGTGGG - Intronic
1043941947 8:86205656-86205678 GGGGAGTGGGGGAGGAAGGAAGG + Intergenic
1044284273 8:90393525-90393547 GGGGGTGGGGGGAGGGAGGAGGG - Intergenic
1044425804 8:92048559-92048581 GTTTATTGTGGGAGGAAGAAAGG + Intronic
1044566694 8:93669614-93669636 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1044713146 8:95076136-95076158 GTGAATTGTGTGAGGAAGGAGGG - Intronic
1044781504 8:95748060-95748082 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1045744742 8:105405421-105405443 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1045805593 8:106157527-106157549 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1046193280 8:110827508-110827530 GTGTGGTGTGGGAGGAGGGAGGG - Intergenic
1046459188 8:114509888-114509910 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1046467941 8:114631427-114631449 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1046547471 8:115669245-115669267 GGGAGGTGGGGGAGGGAGGAGGG - Intronic
1046602472 8:116332501-116332523 GTGGGGTGGGGGAAGAAGGGAGG + Intergenic
1046667791 8:117023720-117023742 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1046732492 8:117740457-117740479 GTGGGGTGGGGGAGGCGGGAGGG - Intergenic
1046744571 8:117862988-117863010 AGGTGTTGGCAGAGGAAGGAAGG + Intronic
1046889809 8:119410568-119410590 TGGGGTTGGGGGAGGAGGGAAGG - Intergenic
1047024392 8:120811127-120811149 GTGTGTTGGGGGGGGGGGAAGGG - Intronic
1047085195 8:121508159-121508181 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1047177452 8:122555034-122555056 ATGTGTTGGGAGTGGAGGGAGGG - Intergenic
1047367312 8:124223230-124223252 GAGAGTTGGGGAAGGAAGAAGGG + Intergenic
1047506376 8:125483926-125483948 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1047637247 8:126777676-126777698 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1048055313 8:130857091-130857113 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1048293633 8:133198781-133198803 GAGGGTAGGGGGAGGAGGGAGGG - Intronic
1048793061 8:138122029-138122051 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1048888092 8:138924692-138924714 GTGTGGTGGGGGAGTAGGGAAGG - Intergenic
1049088744 8:140497613-140497635 TGGGGTTGGGGGAGGGAGGAGGG - Intergenic
1049092082 8:140523835-140523857 GTGGGTTGGGGGAGAAAGAGGGG + Intergenic
1049204994 8:141359515-141359537 GTGTGGTGGGGGTGGCAGGAGGG - Intronic
1049351670 8:142167910-142167932 GTGCGTTGGGGGAGGATTAAGGG - Intergenic
1049465024 8:142747150-142747172 GTGGGTGGGTGGAGGAGGGATGG + Intergenic
1049905281 9:210979-211001 GTGGTTTTGGGGAAGAAGGAAGG + Intergenic
1049930140 9:448421-448443 GGTTGTTGGGGAACGAAGGAAGG - Intronic
1050010317 9:1179356-1179378 GCGTGGAGCGGGAGGAAGGAAGG + Intergenic
1050011512 9:1189951-1189973 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
1050161844 9:2727283-2727305 GTGGGGTGGGGGAGGGGGGAGGG + Intronic
1050403606 9:5283588-5283610 GTGTGTGGGGGGAGGAGATATGG - Intergenic
1050475353 9:6034909-6034931 GTGTGCTGGTGGAGAAGGGAAGG - Intergenic
1050510295 9:6387557-6387579 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1050731792 9:8717247-8717269 GTGTGTTGGGGGGAGAAGCAGGG + Intronic
1050916822 9:11146237-11146259 GAGTGGTGAGGGAGAAAGGAAGG + Intergenic
1051016585 9:12483372-12483394 GTGTGGTGGGTGAGGAGTGAGGG - Intergenic
1051360387 9:16276837-16276859 GGGGGTTCGGGGAGCAAGGACGG + Intergenic
1051407599 9:16755538-16755560 GTGGGATGGGGAAGAAAGGATGG - Intronic
1051676829 9:19566959-19566981 GTGGGGTGGGGGAGGGGGGATGG + Intronic
1051677145 9:19569947-19569969 GTGAGTTGGGAGATGAGGGAAGG - Intronic
1051847983 9:21474370-21474392 GTGTGGTGGGGAGGGAGGGAAGG - Intergenic
1051943049 9:22531706-22531728 GTGGGGTGGGGGAGGAGGGAGGG - Intergenic
1052362821 9:27577892-27577914 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1052416495 9:28184554-28184576 ATGTAAAGGGGGAGGAAGGAGGG + Intronic
1052604540 9:30682074-30682096 ATGGGTTGGGGGAGGGGGGAGGG + Intergenic
1052806608 9:33019243-33019265 GTGAGTGGGGGTAGGAATGAAGG + Intronic
1053305692 9:36982961-36982983 TTGTTATGGGGGAGGAAGTATGG + Intronic
1053360478 9:37483083-37483105 GTGGGATGGGGCAGGATGGAGGG - Intergenic
1053451955 9:38201123-38201145 GTGTGGTGGGGGAGACAGGCCGG + Intergenic
1053477198 9:38391075-38391097 GTGCTGTGGGGGAGGCAGGAGGG + Intergenic
1053685611 9:40518162-40518184 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1053704138 9:40732742-40732764 GTGGGGTGGGGGAAGAAGGGAGG - Intergenic
1053718629 9:40922433-40922455 GTGAGTTGGGGGAAGCAGGGAGG + Intergenic
1054355862 9:64062258-64062280 TGGGGTAGGGGGAGGAAGGAGGG - Intergenic
1054414223 9:64856348-64856370 GTGGGGTGGGGGAAGAAGGGAGG - Intergenic
1054766817 9:69048989-69049011 GTCTGCTGGGGGAGGAATGCCGG - Intronic
1054771834 9:69090557-69090579 CTGGGTTGGGGGAGGGAGGAAGG + Intronic
1054836469 9:69680189-69680211 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055078667 9:72244763-72244785 GAGTGTTGGGGGAGAATAGAAGG + Intronic
1055273598 9:74589354-74589376 GTGTGTTGGGGGAGAGAGGTGGG - Intronic
1055849944 9:80614840-80614862 GTGTGGAGGGGGAGACAGGAAGG - Intergenic
1055918064 9:81427286-81427308 GTGAGGTGGGACAGGAAGGAAGG - Intergenic
1055954434 9:81760995-81761017 GTGTGTTCCAGGAGCAAGGAGGG - Intergenic
1055966438 9:81869469-81869491 GAGGGTGGGGGGTGGAAGGAGGG - Intergenic
1056064566 9:82920662-82920684 TTGTGTTGGAGGTGGAAGGAAGG - Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056729985 9:89157126-89157148 GTTTGTAGTGGGAGAAAGGAGGG - Intronic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1056796075 9:89659771-89659793 GTGGGATGGGGGAGGCAGGCTGG + Intergenic
1057069046 9:92080175-92080197 TAGAGTTGGAGGAGGAAGGAAGG - Intronic
1057111226 9:92473004-92473026 ACGTTTTGGGGGAGGTAGGATGG + Intronic
1057155479 9:92834575-92834597 GTGGGTTGGGGGAGGTACGAAGG + Intergenic
1057272431 9:93658550-93658572 GTGTGTCCTGGGAGGAAGGTGGG + Intronic
1057288102 9:93777055-93777077 GTGTGGCGGGGCAGGAAGGCAGG + Intergenic
1057344950 9:94241460-94241482 GTGGGGTGGGGGAGCAGGGAGGG + Intergenic
1057369445 9:94456952-94456974 GGGGGTGGGGGGAGGAAGGGTGG - Intronic
1057386453 9:94609588-94609610 GTGTGCTGGGGAAGGAAGGCCGG - Intronic
1057513758 9:95703441-95703463 GTGGGTCGGGGGAGGGGGGAGGG + Intergenic
1057747907 9:97766427-97766449 GTGAGTTGGAGGTGGAGGGAGGG + Intergenic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1058093555 9:100833033-100833055 GTGGGTGGGGGGAAGGAGGAGGG + Intergenic
1058117240 9:101098320-101098342 ATGAGATGGGGGAGGAAGGCAGG + Intronic
1058594169 9:106597354-106597376 GAGTGGTGAGGAAGGAAGGAAGG + Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059511501 9:114852309-114852331 GTATGTTGTGTAAGGAAGGAGGG + Intergenic
1059695938 9:116730546-116730568 TTGTGTGGAGGGAGGAAGGGAGG + Intronic
1059709150 9:116851319-116851341 GTGTGTTGGGGGAGGGCTTATGG + Intronic
1059762699 9:117354130-117354152 GTGTGGTGGGGAAGGGCGGAAGG + Intronic
1060017866 9:120102606-120102628 GTGGGGTGGGGGAGGTGGGAGGG + Intergenic
1060073332 9:120569865-120569887 GTGGGTTGGAGTAGGATGGAAGG + Intronic
1060116438 9:120945064-120945086 GTGTGTTGGTGTTGGAAGGGTGG - Intergenic
1060177323 9:121506456-121506478 GGCTGATGGGGGAGGAGGGAGGG + Intergenic
1060198344 9:121637473-121637495 GTCTGGTGGGGGAAGAAGCAGGG + Intronic
1060300520 9:122372067-122372089 GCGAGCTGGGGGAGGAAGGTTGG - Intronic
1060382679 9:123191394-123191416 GTGAGGTGGGGGAGAGAGGAGGG + Intronic
1060383085 9:123195250-123195272 GTGAGATGTGGGAGGAAGAAAGG - Intronic
1060446882 9:123697679-123697701 GGGGGAAGGGGGAGGAAGGAAGG - Intronic
1060767195 9:126303977-126303999 GTTTGTAGTGGGAGAAAGGAAGG - Intergenic
1061113164 9:128590009-128590031 GTGTGTTAGGGAAGAAAGGCTGG - Intronic
1061290590 9:129648691-129648713 GGGTGTGGGGGGAGGAGGAAAGG - Intergenic
1061294957 9:129671997-129672019 GTAGGTGGGGGCAGGAAGGAAGG + Intronic
1061388300 9:130303253-130303275 ATGTGTCAGGGCAGGAAGGATGG + Intronic
1061938816 9:133873109-133873131 GGGGGGTGGGGGAGGGAGGAAGG + Intronic
1062331680 9:136047690-136047712 GTGTGTTGGGTGGGGACGGGAGG - Intronic
1062479018 9:136742963-136742985 CTGTGTCGGGAGAGGAGGGAGGG + Intronic
1062643844 9:137536330-137536352 CTGTGTAGGGGAAGGAAGGGTGG + Intronic
1203366287 Un_KI270442v1:260012-260034 GTGAGGTGGGGGAGGGGGGAAGG + Intergenic
1185460437 X:330776-330798 GTGTGTTGGGGGCTGAGAGACGG + Intergenic
1185573807 X:1154501-1154523 GTGTGATGGGGAAGCAGGGAGGG - Intergenic
1185583092 X:1226130-1226152 GTGGGTGGAGGGAGGAAGGGAGG + Intergenic
1185772155 X:2773082-2773104 GAGGGTGGGAGGAGGAAGGAAGG + Intronic
1185780065 X:2836239-2836261 GTGTGTTGGGGGAGAAAATGTGG + Intronic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186297990 X:8169860-8169882 GTGTGGTGAGGGAGGGAGGGAGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186535408 X:10342036-10342058 TTTTGGTGGGGGAGGAGGGAAGG + Intergenic
1186564115 X:10644005-10644027 TGGGGTTGGGGGAGGGAGGAGGG + Intronic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1186641781 X:11463247-11463269 GTGTGGAGAGGGAGGATGGAGGG + Intronic
1186654334 X:11596422-11596444 GTGGGTTGGGGGAGTAGGGGAGG + Intronic
1186914034 X:14200831-14200853 GGGGGTTGGGGGAGGGGGGAGGG - Intergenic
1187043754 X:15624910-15624932 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1187180940 X:16943319-16943341 GTGGGCTGGGGGACGAAGGGAGG - Intergenic
1187498142 X:19814143-19814165 GTGTGGCAGGAGAGGAAGGAGGG - Intronic
1187596960 X:20783796-20783818 GTGTGTTGGGGGGGCGGGGAGGG + Intergenic
1187618832 X:21027894-21027916 ATGGGATGGGGGAGGAAGGGTGG + Intergenic
1187759737 X:22568019-22568041 TTGTCTTGGGTGAGAAAGGAAGG - Intergenic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1187934718 X:24324897-24324919 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1187965245 X:24605423-24605445 GTGACTGGGCGGAGGAAGGAGGG - Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1188835369 X:34948248-34948270 GTGTGCTGGTGGAGAAGGGAAGG - Intergenic
1189051634 X:37651742-37651764 TGGGGTTGGGGGAGGGAGGAGGG - Intronic
1189192533 X:39122915-39122937 GTGTGTTGGGGATGGGATGATGG - Intergenic
1189309542 X:40009843-40009865 GTGTGTTGGGGGCGGTGGGGTGG - Intergenic
1189320898 X:40086546-40086568 GTGTGTTGGGGATGGAGGGCGGG + Intronic
1189581147 X:42407845-42407867 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1189765091 X:44363106-44363128 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1189778051 X:44487827-44487849 GAGGGAGGGGGGAGGAAGGAAGG + Intergenic
1189814142 X:44808053-44808075 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1189862397 X:45286914-45286936 CTGTGTTTGGGAAGGAGGGAAGG + Intergenic
1189981442 X:46514736-46514758 GTGTAGTGGGTGAGGAAGGAAGG - Intronic
1190056580 X:47184794-47184816 GTGTGATGGGAGGCGAAGGAAGG + Intronic
1190260363 X:48793419-48793441 GGGGGAAGGGGGAGGAAGGAGGG - Intronic
1190410361 X:50131021-50131043 TGGGGTTGGGGGAGGGAGGAGGG + Intergenic
1190504253 X:51110935-51110957 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1190518569 X:51251360-51251382 GTGTGTTGGGGGTCGGGGGAGGG - Intergenic
1190557508 X:51650607-51650629 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1190580932 X:51892974-51892996 GTGTGTTGGGGGAGGAAAGGAGG - Intronic
1190585483 X:51935964-51935986 GTGTGCTGGGGAAGGACAGAAGG - Intergenic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190701846 X:52995215-52995237 GAGTGTAGCGGGAGGAACGATGG + Intronic
1191037887 X:56047407-56047429 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1191196142 X:57725618-57725640 GTGAGATGGGGGAGGGGGGAGGG - Intergenic
1191642804 X:63446600-63446622 GTGGGGTGGGGGAAGAAGGGAGG - Intergenic
1191945037 X:66524423-66524445 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1192021352 X:67395734-67395756 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1192041444 X:67626772-67626794 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1192048029 X:67696982-67697004 TTGGTTTGGAGGAGGAAGGAAGG + Intronic
1192054182 X:67756612-67756634 CTGTTTTAAGGGAGGAAGGAAGG - Intergenic
1192173511 X:68871752-68871774 GTGTGCTGGGGGCTGAGGGAGGG + Intergenic
1192241759 X:69336757-69336779 GAGGGTTGGGGGTGGGAGGAGGG - Intergenic
1192293495 X:69822838-69822860 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1192374620 X:70547292-70547314 CTGGATTGTGGGAGGAAGGACGG + Intronic
1192428536 X:71097353-71097375 GGGAGGTGGGGGAGGAGGGAAGG - Intronic
1192531318 X:71889159-71889181 TGGTGTTGGGGGAGGGTGGAGGG + Intergenic
1192605753 X:72515474-72515496 GCATGTTGAGGGAGGAAGGAAGG - Intronic
1192656014 X:72995674-72995696 GGGTGTTGGGGGAGTGAGGTGGG + Intergenic
1192864387 X:75115780-75115802 GTGTGTTGGGGGGGGGGGCACGG + Intronic
1193071480 X:77310427-77310449 GTGGGTTGGGGGATGAGGGAGGG + Intergenic
1193245494 X:79224052-79224074 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1193261881 X:79417597-79417619 GTGGGGTGGGGGAAGAAGGGAGG - Intergenic
1193370166 X:80686264-80686286 GGGGGTTGGGGGAGGGGGGAGGG + Intronic
1193374375 X:80741051-80741073 GTGGGGTGGGGGAGGGGGGATGG - Intronic
1193416911 X:81236861-81236883 GTGTGTGAGGGAAGGACGGAGGG + Intronic
1193478318 X:81995254-81995276 CTGTATTGGGGGCAGAAGGAGGG - Intergenic
1193505179 X:82333868-82333890 GGGTGTTAGGGGAGTAATGATGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193579539 X:83247183-83247205 GTGAGTGGGGGGAGGGGGGAGGG + Intergenic
1193839742 X:86395528-86395550 TGGGGTGGGGGGAGGAAGGAAGG - Intronic
1193887574 X:87001906-87001928 GGGTGTTGGTGGAGGAAGGAGGG + Intergenic
1194259762 X:91678822-91678844 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194476379 X:94364532-94364554 GTGTGGTGGGGGTGGGGGGAGGG + Intergenic
1194490158 X:94535649-94535671 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1194609334 X:96021349-96021371 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194801310 X:98276838-98276860 CTGGATGGGGGGAGGAAGGAGGG + Intergenic
1194801859 X:98283671-98283693 GTGTGTAGAGGAAGGAAAGAAGG - Intergenic
1194933018 X:99912225-99912247 GTGTGTAGTGGCAGGCAGGATGG - Intergenic
1195162530 X:102184564-102184586 GTGAGTTGGGGGAGGGAGGAGGG + Intergenic
1195202537 X:102564764-102564786 GTGAGGTGGGGAAGGAGGGAAGG - Intergenic
1195214544 X:102686025-102686047 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1195272090 X:103242203-103242225 GAGGGTTGGGGGTGAAAGGATGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195342911 X:103922348-103922370 GTGGGGTGGGGGAGGGGGGAGGG - Intronic
1195364434 X:104113055-104113077 GTGTGTTCGGGGAGGTGGCAAGG + Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195655477 X:107327833-107327855 GTGTGTTAGGGATGGGAGGATGG + Intergenic
1195813314 X:108858282-108858304 GTGGGATGGGGGAGGGGGGAGGG - Intergenic
1195884384 X:109624508-109624530 GGGAGTTGGGGGTGGAAGGTGGG + Exonic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1196253143 X:113485245-113485267 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1196378809 X:115067135-115067157 GTGTGTGGGGGGTTGCAGGAGGG - Intergenic
1196424350 X:115555181-115555203 TGGGGTTGGGGGAGGAGGGAGGG - Intergenic
1196544003 X:116941421-116941443 GTGAGTGGGGGGAGGGAGGAGGG - Intergenic
1197115202 X:122823828-122823850 GTCTGTTGGGGGTGGGTGGAAGG + Intergenic
1197279500 X:124518397-124518419 GTTTGTTGGGGGCGGAGGGGTGG + Intronic
1197290482 X:124650460-124650482 GTTCTTTGGGGGAGGAAGTAAGG + Intronic
1197338754 X:125240555-125240577 GAGTGTAGAGGGTGGAAGGAGGG + Intergenic
1197707890 X:129647229-129647251 GGGTGTGGGGGCAGGAAGAAGGG + Exonic
1197783242 X:130177086-130177108 GGGTGCTGGAGGAGGATGGAGGG - Intronic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1197989802 X:132305923-132305945 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1198063210 X:133068251-133068273 GAGGGTAGAGGGAGGAAGGAGGG + Intronic
1198677566 X:139146968-139146990 GTGGGGTGGGGGAGGGAGGAGGG + Intronic
1198801009 X:140447758-140447780 GTGAGGTGGGGGATGAGGGAAGG - Intergenic
1198811690 X:140542247-140542269 GGGTTTTGGGGGAAGTAGGAAGG + Intergenic
1198823937 X:140679128-140679150 GGGGGTCGGGGGAGGAGGGAGGG + Intergenic
1198833466 X:140776496-140776518 GCGGGTGGCGGGAGGAAGGAAGG - Intergenic
1199140479 X:144305982-144306004 TTGTGTTCGGGGAGGCGGGAAGG + Intergenic
1199204872 X:145137011-145137033 GTATGTTGGGTGTGGAAGGAAGG + Intergenic
1199220959 X:145315154-145315176 TGGTGTTGGGGAGGGAAGGAAGG + Intergenic
1199250405 X:145655378-145655400 GTGTGTGGGGGGAGCAAAGAGGG - Intergenic
1199272480 X:145900315-145900337 GTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1199703403 X:150402922-150402944 TGGGGTGGGGGGAGGAAGGAGGG + Intronic
1199937364 X:152587893-152587915 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1199987782 X:152964760-152964782 GTGTGTTGGGGGCGGGAGGGGGG + Intronic
1200055805 X:153460021-153460043 GGGAGTTGGAGGAGGGAGGAAGG - Intronic
1200114148 X:153762786-153762808 GTGTGTTGGGGTAGGCATGGGGG + Intergenic
1200213802 X:154358612-154358634 GTGTGGTGGGGTAGGAATGGAGG - Intronic
1200343858 X:155427964-155427986 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1200578463 Y:4918015-4918037 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1200912251 Y:8541254-8541276 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
1200977149 Y:9225610-9225632 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201011705 Y:9553256-9553278 GTGTGGTGGGGAAGGAAGAAAGG - Intergenic
1201072400 Y:10160214-10160236 GTGGGGTGGGGGAGGGGGGAAGG - Intergenic
1201415085 Y:13740862-13740884 GTGAGGTGGGGGAGGGGGGAGGG - Intergenic
1201466604 Y:14288135-14288157 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
1201512221 Y:14777623-14777645 GTGTGAGGGGGGAAGAGGGAGGG + Intronic
1201546213 Y:15164858-15164880 TGGGGTTGGGGGAGGAGGGAGGG + Intergenic
1201551926 Y:15226634-15226656 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1201572738 Y:15431909-15431931 GGGAGTTGGGGGAGGGGGGAGGG + Intergenic
1201587063 Y:15572659-15572681 TTGGGGTGGGGGAGGAGGGAGGG + Intergenic
1201651294 Y:16290570-16290592 GTGGGTTGGGGGAGGGGGGAGGG - Intergenic
1201675325 Y:16575629-16575651 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201736177 Y:17264371-17264393 GTGGGGTGGGGGAGGCTGGAGGG + Intergenic
1201976596 Y:19855961-19855983 GTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1202087702 Y:21155982-21156004 GTGGGGTGGAGGAGGAGGGAGGG - Intergenic
1202241308 Y:22773394-22773416 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202394294 Y:24407137-24407159 GAGGGTTGGGGGAGGGGGGAGGG - Intergenic
1202476491 Y:25262955-25262977 GAGGGTTGGGGGAGGGGGGAGGG + Intergenic