ID: 931758330

View in Genome Browser
Species Human (GRCh38)
Location 2:65394345-65394367
Sequence GGCGCCAGCAGCCACCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931758330_931758337 19 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758337 2:65394387-65394409 AGAGGCAGCTGTGAATGGACAGG 0: 1
1: 0
2: 3
3: 22
4: 289
931758330_931758338 26 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758338 2:65394394-65394416 GCTGTGAATGGACAGGAACAAGG 0: 1
1: 0
2: 3
3: 24
4: 252
931758330_931758336 14 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758336 2:65394382-65394404 CGGATAGAGGCAGCTGTGAATGG 0: 1
1: 0
2: 0
3: 13
4: 113
931758330_931758334 1 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758334 2:65394369-65394391 TGCACAGACCACTCGGATAGAGG 0: 1
1: 0
2: 0
3: 3
4: 79
931758330_931758339 27 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758339 2:65394395-65394417 CTGTGAATGGACAGGAACAAGGG 0: 1
1: 1
2: 1
3: 22
4: 224
931758330_931758331 -6 Left 931758330 2:65394345-65394367 CCATCAGGGTGGCTGCTGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 195
Right 931758331 2:65394362-65394384 GGCGCCCTGCACAGACCACTCGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931758330 Original CRISPR GGCGCCAGCAGCCACCCTGA TGG (reversed) Intronic
900896251 1:5484945-5484967 GTCCCCAGCAGCAGCCCTGAGGG + Intergenic
901153504 1:7120452-7120474 GAAGCAAGCAGCCACCTTGAAGG - Intronic
901701563 1:11047173-11047195 GGCGCCCACAGCCTCCCTGCAGG - Intronic
902060174 1:13635210-13635232 GCTACCAGCACCCACCCTGATGG - Intergenic
905693620 1:39959983-39960005 TCTGCCAGGAGCCACCCTGAAGG - Intronic
906695251 1:47819157-47819179 AGGGCCAGCGGCCACCCTGCAGG + Intronic
911618225 1:100038109-100038131 GGCGCCCGCCGCCATCTTGAGGG - Exonic
912480412 1:109978406-109978428 GCCCCCAGCAGGCATCCTGAAGG + Intergenic
912988503 1:114459163-114459185 GCAGCCAGCACCCATCCTGATGG - Intronic
918078760 1:181190135-181190157 GGCCCCAGCAGCCCCGCTGCGGG - Intergenic
918232847 1:182551300-182551322 GGCTCCAGCAAACACCCTCAAGG - Intronic
918275811 1:182953010-182953032 GGCGGCCGCGACCACCCTGAAGG - Exonic
918407551 1:184225839-184225861 GGCGGCAGCAGCCACGCAGGAGG + Intergenic
919086560 1:192927723-192927745 GGTGCCAGCAGCCTCCCTGCTGG - Intergenic
919430647 1:197487355-197487377 GGTACCAGCACCCACTCTGATGG - Intergenic
920114425 1:203609942-203609964 GGCCCCAGCATCCAGCCTCAGGG + Intergenic
920409578 1:205749381-205749403 GGGGCCTGCAGCGACCCCGAAGG + Intronic
920648604 1:207820941-207820963 GTCTCCAGCAGCCTCCCTGTGGG - Intergenic
921345971 1:214185502-214185524 GGCTGCAGCAGCCTCCCTGCTGG - Intergenic
924514005 1:244751291-244751313 GGCCGCAGCAGCCACAATGACGG - Intergenic
1063482547 10:6388566-6388588 GGAGCCAGCTGCCACACTGTGGG - Intergenic
1064325686 10:14349235-14349257 GGAGCCAGCACACCCCCTGATGG - Intronic
1065390269 10:25175487-25175509 GGCGCCAGCCGCGACCCCCAAGG + Exonic
1065410191 10:25417766-25417788 GATGCCAGAAGACACCCTGAGGG + Intronic
1066409188 10:35149556-35149578 GACTCCACCAGGCACCCTGATGG - Intronic
1067532569 10:47085322-47085344 GGGGGCAGGAGCCAACCTGAAGG - Intergenic
1068955048 10:62814306-62814328 GGTGCCAGCTGCTACCCAGAAGG - Exonic
1070763661 10:79044128-79044150 GGTTACAGCAGGCACCCTGAGGG + Intergenic
1073024766 10:100479890-100479912 GGCACCAGCTGCCACACTGCTGG - Exonic
1076670839 10:132120368-132120390 GGCTCCAGCAGCCACCCCTGGGG - Intronic
1076699606 10:132264606-132264628 GGGGCCAGATGCCATCCTGAGGG + Intronic
1077144707 11:1039751-1039773 GGAGCCAGCGCCCACCCTAACGG - Intergenic
1084892585 11:72243910-72243932 GGCGCCTGCAGCCAGCCCGGCGG - Exonic
1086173543 11:83862933-83862955 GGACCTAGCAGCTACCCTGAAGG + Intronic
1087031940 11:93715075-93715097 GGGGCCACTTGCCACCCTGAAGG - Intronic
1089496625 11:118911357-118911379 GGCCCCACCTGCCACCCTGCGGG + Intronic
1096180675 12:49548888-49548910 AGCTCCTGCAGCCAGCCTGAGGG - Exonic
1096542143 12:52313844-52313866 AGTGCCAGCAGCCACCCTTGGGG - Intergenic
1096607487 12:52777067-52777089 GCTGCCAGCTGCCACGCTGATGG + Exonic
1096610183 12:52795821-52795843 GCCGCCAGCTGCCACGCTGATGG + Exonic
1097994153 12:65869382-65869404 GGCTCCATCAACCACCCAGATGG - Intronic
1098358896 12:69636073-69636095 GGTGACAGCCTCCACCCTGAAGG - Intergenic
1098594776 12:72259323-72259345 GGATCCAGGAGCCACCTTGAAGG - Intronic
1103562607 12:121800310-121800332 GGCGTCTGCGGCCACCCCGAGGG + Intronic
1104148193 12:126055583-126055605 GGAGCCAGCAGCCTTCCTGCTGG + Intergenic
1104800938 12:131554913-131554935 GGAGCCAACAGCCACCATGGTGG - Intergenic
1104990312 12:132620763-132620785 GGTGCCAGCAGCCAGCCCCATGG - Intronic
1105405209 13:20127746-20127768 GGCCCCAGCATTGACCCTGAGGG - Intergenic
1107694381 13:42986152-42986174 GGCCCCAGCTGCCACCCTTTTGG - Intronic
1112790825 13:103000670-103000692 GGGGCCAGCAGAAACCCTTATGG - Intergenic
1118076787 14:62308251-62308273 GGCATCATAAGCCACCCTGAAGG - Intergenic
1118325547 14:64778122-64778144 GGCTCCAGCAGCCACACGCAGGG - Intronic
1118613854 14:67562151-67562173 GGCACCAGCAGCTTCCGTGAAGG - Exonic
1119617628 14:76109270-76109292 GGCGCCAGCTGCAACACTGCGGG + Intergenic
1119852951 14:77879077-77879099 GGCTCCCTCAGCCACCGTGAAGG + Intronic
1122096763 14:99378112-99378134 GGAGACAGCAGCCACCCAGAAGG + Intergenic
1122830046 14:104391453-104391475 GGCCGCAGCACCCAGCCTGAAGG + Intergenic
1124360889 15:29035915-29035937 GGTGACAGCTGGCACCCTGAGGG - Intronic
1124712814 15:32029943-32029965 GGCGCCAGCAGCCAGACTCTCGG - Intergenic
1125980642 15:43997482-43997504 ATTGCCAGCAGGCACCCTGAAGG - Intronic
1128142488 15:65311986-65312008 GTCCCCAACAGCCACCCAGATGG - Intergenic
1128300815 15:66565413-66565435 GGCCCCTGCAGCCAGGCTGATGG + Exonic
1128329257 15:66745114-66745136 GGTGCCACCAGCCACCTTGGAGG - Intronic
1129300927 15:74625048-74625070 GGGTCCAGCAGCCCCACTGAAGG - Intronic
1129543126 15:76367562-76367584 GTAGGCAGCAGCCAGCCTGAGGG - Intronic
1131407174 15:92174843-92174865 GGAGCCAGCTGCCAAGCTGAGGG - Intergenic
1131850874 15:96542197-96542219 GACCCCAGCAGCCATCCTGCTGG + Intergenic
1132465535 16:75778-75800 GAGGCCAGCAGCCACCCTGCTGG + Intronic
1132517586 16:373058-373080 GGAGACTGAAGCCACCCTGATGG - Intronic
1132546662 16:536293-536315 AGCACCAGCAGCCACCCCCAGGG - Intronic
1132663512 16:1071761-1071783 GGCGCCAGCAGCTCCCTTGAAGG - Intergenic
1132884378 16:2176173-2176195 TGGGCCAGCACGCACCCTGAGGG - Exonic
1132897015 16:2233947-2233969 CCCGACAGCAGCCACCCTGGAGG + Exonic
1133110591 16:3545838-3545860 GGTCCCAGAAGCCACCCTGAGGG + Intronic
1133339437 16:5027160-5027182 GCCACCTGAAGCCACCCTGAGGG - Exonic
1136498392 16:30657962-30657984 CTCGCAAGCAGCCAGCCTGACGG + Intergenic
1136568825 16:31084923-31084945 GGAGCCTACACCCACCCTGAGGG - Exonic
1137591159 16:49694753-49694775 GGCACCGCCAGCCACACTGAGGG + Intronic
1139873579 16:70127253-70127275 AGAGCCAGCAGCCAGCCTGCAGG - Exonic
1140362199 16:74353895-74353917 AGAGCCAGCAGCCAGCCTGCAGG + Intergenic
1141691963 16:85601571-85601593 GGGGCCGGCAGACACCCAGAAGG + Intergenic
1143323697 17:6084428-6084450 GGCCCCAGCAGCTGTCCTGAGGG - Intronic
1144444547 17:15314863-15314885 CACTCCAGCAGCCACCCTGCTGG + Intronic
1145052995 17:19678724-19678746 GGCGGCGTCAGCCACACTGATGG - Exonic
1146123582 17:30215465-30215487 GGGGCCTGCAGCACCCCTGAGGG + Intronic
1146935671 17:36811202-36811224 GAGGCCACCAGCCACCCTGATGG - Intergenic
1147508729 17:41047042-41047064 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147509468 17:41054986-41055008 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147509976 17:41059825-41059847 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1147510569 17:41065620-41065642 GGCGGCAGCAGCCTTCCTGCAGG + Exonic
1148329782 17:46806873-46806895 GTCCCCAGCAGCCATCGTGAGGG - Intronic
1148596553 17:48860819-48860841 AGTTACAGCAGCCACCCTGATGG + Intronic
1150221544 17:63498203-63498225 GCTGCCAGCAGCCACCCTGCTGG + Intronic
1151567445 17:74907184-74907206 GGCCTCAGCTGCCTCCCTGAGGG - Intergenic
1152658083 17:81529227-81529249 GGGGCCCGCAGGCACCCTCAAGG + Exonic
1152705009 17:81838848-81838870 CGGGCCTGCAGACACCCTGAGGG + Intergenic
1154490611 18:14919316-14919338 GAAGCCAGCAGCCATCCTGGAGG + Intergenic
1156483590 18:37450971-37450993 GGCGCCCACAGCCACACTCAGGG - Intronic
1158398170 18:57095921-57095943 CTTGTCAGCAGCCACCCTGAAGG - Intergenic
1159390963 18:67791053-67791075 GTGGCCAGCAGCCAACCTGTAGG + Intergenic
1160237025 18:77093815-77093837 GGAGCCAGCAGCCTCCCCTAAGG - Intronic
1160510037 18:79448277-79448299 GGCCCCAGCACCCTTCCTGATGG - Intronic
1160564612 18:79779505-79779527 GCAGCCAGCAGCCGCCCTGCCGG + Intergenic
1161133889 19:2608421-2608443 CGCCCCAGCAGGCACACTGACGG + Intronic
1161153668 19:2721613-2721635 GGCCCCAGCTCCCACCCCGAGGG - Intronic
1161718727 19:5891925-5891947 GGTCCCAGCAGGCTCCCTGAGGG - Exonic
1163427817 19:17248638-17248660 GGTTTCAGCTGCCACCCTGAAGG + Intronic
1164685102 19:30161364-30161386 GGAGAGAGCAGCCCCCCTGAAGG + Intergenic
1164797494 19:31045825-31045847 GGCCCCAGATGCCACCCTGTGGG - Intergenic
1165444393 19:35848944-35848966 GGTGCCAGCTGCCCCCCTGTCGG - Intronic
1167391230 19:49196491-49196513 GGCCCCCGCAGCAACCCGGACGG - Exonic
1167621952 19:50565720-50565742 GGCCCCAGCAGGCACCCCGCGGG + Intronic
1168607236 19:57769845-57769867 GGCGGCAGCAGCCGCTCTGAGGG + Exonic
1168610636 19:57796687-57796709 GATGGCAGCAGCCACACTGAGGG - Intronic
1168617362 19:57849568-57849590 GATGGCAGCAGCCACACTGAGGG + Intronic
928394821 2:30935447-30935469 GGCGGCAGCAGCCAGCCTGAAGG - Intronic
930817802 2:55617279-55617301 GGAGACAGCAGCCACCATGTCGG - Exonic
931758330 2:65394345-65394367 GGCGCCAGCAGCCACCCTGATGG - Intronic
933460529 2:82577982-82578004 GGCGCCCGCCGCCACCATGCAGG - Intergenic
935284951 2:101556298-101556320 GGAACCAGCAGACAGCCTGAGGG - Intergenic
944672552 2:202007158-202007180 GGCCCCATCAGAGACCCTGACGG + Intergenic
948627068 2:239275851-239275873 GGTGCCACGTGCCACCCTGAAGG + Intronic
949046498 2:241874771-241874793 GGAGACAGCAGCCAGCCTGCGGG + Intergenic
1168806443 20:675000-675022 GGCGCCCCCAGCCACCCCCAGGG + Intronic
1168952291 20:1810741-1810763 GCCCCCAGCAGCCACCCTCTGGG + Intergenic
1169464462 20:5825321-5825343 GGAGCCTGCAGCCACCCAGTGGG - Intronic
1172428574 20:34872689-34872711 GGCGCCCGCGGCCCCGCTGAGGG - Exonic
1175808824 20:61846367-61846389 GGAGCCAGCAGCCATGCTGAGGG - Intronic
1179407951 21:41140738-41140760 GGCGGCAGCAGCGACACTGCTGG - Intergenic
1179613453 21:42566769-42566791 GGCAGCAGCTGCCACCATGAGGG - Intronic
1179831870 21:44001883-44001905 GGCAGGAGCAGCCACCCTGCTGG - Intergenic
1179967380 21:44815363-44815385 GGCTCCAGCTGCGAGCCTGAAGG + Intronic
1181521852 22:23452797-23452819 GGCATCAGCAGCCATCGTGAGGG - Intergenic
1183427644 22:37747973-37747995 GGTGGCAGCAGCCTTCCTGAGGG + Intronic
1183447695 22:37869557-37869579 GGCTCCAGCAGTCACACAGATGG - Intronic
1183543060 22:38441057-38441079 GGCCCCAGCAGCCCCACAGATGG + Intronic
1184188833 22:42881561-42881583 GGCCCCACCTGGCACCCTGAAGG - Intronic
1184545334 22:45163766-45163788 GGCGCCAGCAGCCGCGCTTTGGG - Intergenic
1185287990 22:50010923-50010945 GCCGCGAGCAGCCGCCCTGGGGG - Intronic
949969918 3:9396460-9396482 GGCGCGAGCTGCAATCCTGAGGG - Intergenic
953173106 3:40525165-40525187 AGCCCGAGCAGCCACCTTGACGG - Exonic
954292401 3:49656509-49656531 GGCTCCTGCAGCCTCCTTGATGG - Exonic
954498600 3:50988628-50988650 GGGGCCAGTTGCCAGCCTGAAGG - Intronic
954554535 3:51507532-51507554 GGAGCCAGCAGGCATCCTGTGGG + Intergenic
954710066 3:52501253-52501275 AGCTCCCGCAGCCAGCCTGAGGG - Exonic
955067570 3:55546160-55546182 GGCGACAGCAGCTACCCAGGAGG + Intronic
959566140 3:107834746-107834768 GAAGCCATCAGGCACCCTGAAGG + Intergenic
961643292 3:128378707-128378729 GGGGCCAGCAGCCAGCCTGGGGG - Intronic
961887440 3:130105568-130105590 GGCGCTGGCAGAGACCCTGATGG - Intronic
962355151 3:134687513-134687535 TGCACCAGCAGGCACCCTGGGGG - Intronic
968870655 4:3240409-3240431 GGGGCCAACAGCCAGCCTGCAGG - Exonic
972640835 4:40923600-40923622 GGCAGCAGCCGCCATCCTGATGG - Intronic
976607935 4:87000004-87000026 GGGGCAAGGAGCCAACCTGAAGG + Intronic
978854815 4:113382312-113382334 GACTCCAACAGCCACTCTGAGGG + Exonic
979033210 4:115678632-115678654 GGCCTCAGCGGCCTCCCTGAGGG - Intergenic
980865933 4:138553362-138553384 GGCCCCAGCCGCCTCCCTGCGGG + Intergenic
987040214 5:14055217-14055239 ACCCCCAGCAGGCACCCTGAGGG - Intergenic
987237443 5:15957295-15957317 GACCCCAGCAGCCACCCTGCAGG + Intergenic
988993065 5:36690204-36690226 GGGGCCCGCGGCCACCCGGAAGG - Intergenic
995394506 5:111673118-111673140 AGCCCTAGCAGCCAACCTGAGGG - Intronic
996819712 5:127612863-127612885 GGCACCAGCAGCCAGCTGGATGG + Intergenic
997520975 5:134524686-134524708 GGCGCCAGGAGGCACCCGGGAGG + Intronic
997646755 5:135487192-135487214 GGGCTCAGCAGCCTCCCTGATGG + Intergenic
999133125 5:149299642-149299664 GCCGCCAGCAGCCTGCCTGGAGG + Intronic
1001060690 5:168486388-168486410 GGCGCCAGCACCCAGTCCGACGG + Intergenic
1001694206 5:173657918-173657940 GGGGCCAGGAGCGAGCCTGAAGG + Intergenic
1002441647 5:179267386-179267408 GGCTGCAGCATCCTCCCTGACGG - Intronic
1002899816 6:1401162-1401184 GGCTCCAGCAGCCCCCCTTCTGG + Intergenic
1004318489 6:14613373-14613395 GGGGCCAGCATCCAGCCTGCTGG - Intergenic
1006121704 6:31810823-31810845 GGTACAAGCAGCCATCCTGATGG - Exonic
1006348489 6:33502910-33502932 GGCCTCAGCTGCCTCCCTGAGGG + Intergenic
1007073952 6:39055018-39055040 GGCGGCAGGGGCTACCCTGAAGG - Intronic
1010738740 6:79472945-79472967 GGCTCCAGATACCACCCTGATGG - Intergenic
1012472642 6:99589054-99589076 TGCGGCAGCAGCAACCCCGAGGG - Intergenic
1015594655 6:134854880-134854902 GGCAGCAACAGCCTCCCTGAAGG - Intergenic
1017651812 6:156590524-156590546 GGCGCCAGCAGCCTCCAGCAAGG + Intergenic
1018551324 6:165001768-165001790 GGCCTCAGCTGCCTCCCTGACGG - Intergenic
1018695827 6:166390718-166390740 GAAGCCAGCAGCCCCACTGAGGG + Intergenic
1018908582 6:168089096-168089118 GGGGCCAGCAGCCTGCCTGGGGG + Intergenic
1019444580 7:1064728-1064750 GGGGCCAGCAGGGACCCTGGGGG + Intronic
1020121983 7:5509759-5509781 GGGGCCAGCACCCAACCTGGTGG + Intronic
1021100728 7:16584510-16584532 TGAGCCAGCAGCCACCGTGGCGG + Intergenic
1022388745 7:29925564-29925586 GTCCACAGCAGCCACCCCGATGG - Intronic
1024262392 7:47582131-47582153 GGCGCCGGCAGCCAGCCAGGAGG - Exonic
1024297491 7:47857094-47857116 GGAGCCAGGGGCCACCCTGCAGG + Intronic
1026467958 7:70670842-70670864 GTTGACAGTAGCCACCCTGAAGG + Intronic
1027228926 7:76261159-76261181 AGCGCCATCAACTACCCTGAGGG + Intronic
1030824683 7:114140788-114140810 GGCTCCTTTAGCCACCCTGAGGG + Intronic
1032227486 7:130044479-130044501 GGCCACAGAAGCCAACCTGAGGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1041271483 8:56113504-56113526 GGCGCCGCCGGCCACCCTGAGGG - Exonic
1042735314 8:71981285-71981307 AGCAGCAGCAGCCCCCCTGATGG + Intronic
1042882719 8:73511667-73511689 GGCACCAGCTGCCACCCACATGG - Intronic
1046279649 8:112009191-112009213 AGCACTAGCAGCCACCTTGAGGG + Intergenic
1047735795 8:127764008-127764030 GACGCCAGCTGCCACTTTGATGG + Intergenic
1048661415 8:136606882-136606904 TGCTCCAGCAACCACACTGATGG + Intergenic
1049312906 8:141942877-141942899 GGTCCCAGCATACACCCTGAAGG - Intergenic
1049812669 8:144582448-144582470 GGCCCCAGCAGCAGCCCTGGGGG + Intronic
1055463412 9:76540518-76540540 GGACACAGGAGCCACCCTGAAGG - Intergenic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057231668 9:93325131-93325153 GGCACCAGCACCCTCGCTGATGG + Intronic
1058795771 9:108496935-108496957 GAAGCCAACAACCACCCTGAAGG - Intergenic
1061357307 9:130116206-130116228 GGGGCCCACAGCCACCCAGAGGG + Intronic
1062420859 9:136481726-136481748 GTCACTAGCAGCCACCGTGAGGG - Intronic
1062565677 9:137163008-137163030 GGCGCGGGCGGCCACCCTGGCGG + Intronic
1187419518 X:19122455-19122477 GGCGCCAGCAGCCAGCCCCGAGG - Exonic
1190021012 X:46875675-46875697 GGAGACAGAAGCCAGCCTGAAGG - Intronic
1190227877 X:48559995-48560017 GCCGCCAACTTCCACCCTGACGG + Exonic
1190300265 X:49053374-49053396 GGCGCCAGTAGGCTCCCTGAGGG + Intergenic
1191902271 X:66053564-66053586 TGCTCCAGCAGGGACCCTGAGGG - Intergenic
1197958786 X:131981157-131981179 GACGCCAGCAGGTACCCTGAGGG - Intergenic
1200225007 X:154412369-154412391 GGCTCCTGCAGCATCCCTGAGGG + Intronic