ID: 931758746

View in Genome Browser
Species Human (GRCh38)
Location 2:65397576-65397598
Sequence AACAGATTGTAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931758746_931758747 27 Left 931758746 2:65397576-65397598 CCTTCACATTTCTACAATCTGTT 0: 1
1: 0
2: 0
3: 31
4: 309
Right 931758747 2:65397626-65397648 TGCCCTTTACTCACAATACAAGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931758746 Original CRISPR AACAGATTGTAGAAATGTGA AGG (reversed) Intronic
907562938 1:55407788-55407810 AAAAGATTGGAGAAAGGTGATGG - Intergenic
908616145 1:65924940-65924962 AACAGAATATATAAAAGTGATGG - Intronic
910098287 1:83549090-83549112 ATCAGATTATAGAGATGTTAGGG - Intergenic
910435923 1:87205775-87205797 AAGAGTTTATAGAAATGTGGTGG + Intergenic
910492720 1:87790473-87790495 AATAGAGTGTAGAACAGTGAAGG + Intergenic
911329325 1:96509007-96509029 AAAAGATTTTAGAATTGTGAAGG + Intergenic
911412447 1:97526782-97526804 AACACATTGTCCAAATGTTAAGG + Intronic
911681896 1:100726393-100726415 GACAGTTTTAAGAAATGTGATGG - Intronic
912510111 1:110183909-110183931 AAGAGATGGGAGAAATGTGTGGG + Intronic
915572819 1:156754276-156754298 AACAAAGTGGAGAAATGGGAAGG - Intronic
918409122 1:184240420-184240442 AGAAGATTGTACAGATGTGAGGG + Intergenic
920932356 1:210400752-210400774 AGATGATTGTAGAACTGTGATGG + Intronic
921309290 1:213826913-213826935 AGCAGAGTGTAGCAATGTGATGG - Intergenic
921791271 1:219293285-219293307 GAGAGATAGTAGAAATGGGAAGG + Intergenic
923209410 1:231789484-231789506 AACAGACTGTAGAGGAGTGAGGG + Intronic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
1063779317 10:9303381-9303403 AACAGGTTGTAGAAATAAAATGG - Intergenic
1065150089 10:22813676-22813698 AACAGATTGGAGAAATATTTAGG + Intergenic
1066265187 10:33769979-33770001 AACAGATTTTAGAAAAGAAAGGG + Intergenic
1066481910 10:35804525-35804547 ATCAAATAGTAGAAATGTAACGG + Intergenic
1067833596 10:49624324-49624346 AAATGTTTGTAGCAATGTGATGG - Intronic
1068334783 10:55620396-55620418 ACCATTTTGTACAAATGTGAGGG - Intronic
1068384342 10:56305803-56305825 AACAGATTTTAGAATGTTGAAGG - Intergenic
1068555570 10:58454958-58454980 AACAGATGGTAGAGAGGGGAGGG + Intergenic
1069011125 10:63373732-63373754 TACAGATTTGAGAAATTTGAGGG - Intronic
1069818845 10:71215256-71215278 CACAGATTGAAGACATGTGAAGG + Intronic
1071149341 10:82615744-82615766 AAGAGATAGTAAAAATGTGGAGG + Intronic
1071263671 10:83944385-83944407 AACAAATTCAAGAAATGTGATGG + Intergenic
1072243416 10:93519153-93519175 AACAGATTCTTGAGGTGTGATGG + Intronic
1073244102 10:102077350-102077372 GGCAGATGGTAGAAATGGGATGG + Intergenic
1073522032 10:104141252-104141274 AAAAGATTGTATAATTTTGACGG + Intronic
1074575718 10:114667250-114667272 ATCTGATTTTAGAAATGGGAAGG - Intronic
1074586968 10:114777248-114777270 AACACATTTTAGAAATGAAAAGG - Intergenic
1075044807 10:119138535-119138557 AACAGATGACAGAAATGTGAAGG - Intergenic
1075207586 10:120460398-120460420 CACATAGTGTAGAAATGAGATGG + Intronic
1076134204 10:128034137-128034159 ATCAGATTCTAGAAATGTTCGGG + Intronic
1078909745 11:15719745-15719767 AAAAAATTGTAAAAAGGTGATGG - Intergenic
1080845456 11:36023054-36023076 AGCAGATTGTAGAAGCGGGATGG + Intronic
1081930019 11:46862933-46862955 AAAAGATTATGCAAATGTGATGG + Intronic
1083168718 11:60908962-60908984 AACAAATTGTGGGAAGGTGAGGG + Intergenic
1084097487 11:66921246-66921268 AAGAGTTTGAAGAAATGTAAAGG - Intronic
1085073198 11:73567175-73567197 AATAGATTCGAGAAATGTTAAGG + Intronic
1085291445 11:75402992-75403014 TGCAGATAGTAGTAATGTGAGGG + Intronic
1085725999 11:78955223-78955245 GTGAGATTGGAGAAATGTGAAGG - Intronic
1086432773 11:86751490-86751512 AACAGAATATGGAAAGGTGATGG - Intergenic
1087388980 11:97510505-97510527 AACAGATTGTATATATTTGGAGG + Intergenic
1088006076 11:104942145-104942167 GACAGAATGTAGAATGGTGATGG - Intergenic
1088223814 11:107597114-107597136 ATAAAATTGTAGAAATGTCATGG - Intronic
1090984609 11:131755005-131755027 GACAGAAAGCAGAAATGTGAAGG + Intronic
1091012286 11:132013526-132013548 AACAGAATCTAGAAAAGTGGTGG + Intronic
1092726832 12:11495059-11495081 AAGAGTTTGTAAAAATGTGAAGG + Intronic
1094192536 12:27711659-27711681 AAAAACTTGTAGAAATGAGATGG - Intronic
1094197198 12:27761607-27761629 AACAGAATGTATACAAGTGAGGG + Intergenic
1095260769 12:40096412-40096434 AACAGATTGGAAAAATATTATGG - Intronic
1095487306 12:42698699-42698721 AAGAGATTTTAGTAATGTCATGG - Intergenic
1095683744 12:45008454-45008476 AACAGATTGAAGAGATGTTAAGG + Intergenic
1096696647 12:53353471-53353493 ACCACAGTGTAGAACTGTGAAGG + Intergenic
1097391718 12:59022898-59022920 AAAAGATGGTTGAAATGTGTGGG - Intergenic
1099199744 12:79661295-79661317 GACAGATTGTAGAAATATTATGG - Intronic
1099891212 12:88590701-88590723 AACGAGTTGTAGAAATGTGATGG + Intergenic
1100236265 12:92664273-92664295 AAAAGATTTTAGAAAAGTAAGGG + Intergenic
1102780465 12:115560173-115560195 AACAGTTTTTTGAAACGTGATGG + Intergenic
1102892989 12:116575752-116575774 AACAGATAGTAAATATATGATGG + Intergenic
1104033692 12:125083461-125083483 AACAGACTGTACAAATGGGAAGG - Intronic
1104147401 12:126048557-126048579 AACAGAATGTAGAAAAGCCAGGG - Intergenic
1104381134 12:128308910-128308932 AATGGATTTTAAAAATGTGATGG + Intronic
1105527349 13:21188162-21188184 AACATACTGTAGAATTTTGAGGG + Intergenic
1106069162 13:26390379-26390401 AACAGATTGTAGTGCTGTGCTGG + Intronic
1106468922 13:30037609-30037631 AATAGATTGTAGAAATTCAAAGG - Intergenic
1107855907 13:44615271-44615293 ATCAGATGGTGGAAGTGTGAGGG + Intergenic
1108023946 13:46159033-46159055 AACAGCTTTTAGAGAGGTGAGGG + Intronic
1108323474 13:49308072-49308094 AAGTGATTGTAACAATGTGAAGG - Intergenic
1108979136 13:56488312-56488334 AATAGTTTGTGGAAATGAGATGG - Intergenic
1109130518 13:58578759-58578781 ACCAGATACAAGAAATGTGAAGG - Intergenic
1109572444 13:64210631-64210653 AACAGATAGAAGAAATTTGTGGG - Intergenic
1109742342 13:66570667-66570689 AACAGATTTTAGAAAAGAAAAGG + Intronic
1110003329 13:70233235-70233257 AACAGAATGTAGAAAGTTAATGG + Intergenic
1110219346 13:73057290-73057312 AACAGATTATAGAATTAGGATGG - Intronic
1110399944 13:75078496-75078518 CACAGATGGTAGAAGTATGAGGG - Intergenic
1111087052 13:83389504-83389526 AACATATTTTAGAAATGAAAAGG + Intergenic
1111674619 13:91371531-91371553 AACATATTTTAGAAAAGTAAAGG + Intergenic
1113044085 13:106135566-106135588 AACAGACTGCAGTAATGTCAAGG + Intergenic
1113573492 13:111377050-111377072 AACTTATTCTAGGAATGTGAGGG - Intergenic
1114574915 14:23703949-23703971 AAATGACTGTAGAAATGTCAAGG - Intergenic
1114794830 14:25701739-25701761 ACCACATTGTAGAAAAGAGACGG - Intergenic
1115506919 14:34101698-34101720 GCCAGGTTGGAGAAATGTGAAGG - Intronic
1116067715 14:40005220-40005242 AACAGAATATAGCAAAGTGATGG - Intergenic
1116189302 14:41643243-41643265 AACAGTTTGGAAAAATGTAATGG - Intronic
1116426176 14:44794654-44794676 AAAAGATATTTGAAATGTGAGGG + Intergenic
1117100707 14:52343456-52343478 AACAAATGGTAAAAAGGTGAGGG + Intergenic
1117725523 14:58669232-58669254 GCCAGAATGCAGAAATGTGACGG - Intergenic
1120720406 14:87884456-87884478 AAAATATTATATAAATGTGATGG + Intronic
1121229312 14:92345011-92345033 TACAAATTGTTGAAGTGTGAAGG + Intronic
1124343815 15:28907938-28907960 AACAGATTTTAGAAACGAAAGGG - Intronic
1124964107 15:34420585-34420607 AACAGATTTTAGAAATGAAAGGG + Intronic
1124980720 15:34566813-34566835 AACAGATTTTAGAAATGAAAGGG + Intronic
1126347079 15:47707570-47707592 GACAGAGTCTAGGAATGTGAAGG + Intronic
1128026820 15:64444830-64444852 TAAGGATTGTAGAAAGGTGAAGG + Intronic
1130397410 15:83514940-83514962 AAGAGATTGGAGTGATGTGAAGG + Intronic
1130753156 15:86734876-86734898 AATATGTTGTAGAATTGTGAGGG + Intronic
1131593353 15:93772566-93772588 AAAAGAAAGTAGAAGTGTGATGG + Intergenic
1131613958 15:93994160-93994182 CACACATTGTGGAAATGTCAAGG + Intergenic
1131660932 15:94515208-94515230 AAAAAATTGTATAAATGTAAGGG - Intergenic
1132260787 15:100423117-100423139 AACAGATTTTGGCAATGTGATGG + Intronic
1133654792 16:7850509-7850531 TACAGATTTTAAAAATGTAAGGG - Intergenic
1134155044 16:11836131-11836153 AACAGATGGTGAGAATGTGAAGG - Exonic
1135791020 16:25395948-25395970 GACAGATAGTGAAAATGTGAAGG - Intergenic
1135858509 16:26033766-26033788 AACAGACTGTAGAATTGAGCAGG + Intronic
1136696928 16:32089590-32089612 AACATATTGTACAAATCTTAGGG + Intergenic
1136797428 16:33032880-33032902 AACATATTGTACAAATCTTAGGG + Intergenic
1137223076 16:46474638-46474660 AACAGTGAGTACAAATGTGATGG - Intergenic
1140873583 16:79129287-79129309 AAAAGATTGTATAAATGAGGGGG + Intronic
1141938705 16:87259872-87259894 ACCAGATGGTAGAAATTTGTGGG + Intronic
1144167833 17:12629722-12629744 AACAGATTTTGGACATGTCATGG - Intergenic
1144329179 17:14208616-14208638 AATGAATTGTACAAATGTGAAGG - Exonic
1144802913 17:17943497-17943519 AAGAGAATGTAGGAATGTGAAGG + Intronic
1145693614 17:26769659-26769681 AATATATTGTAGAAATCTTAGGG - Intergenic
1149078092 17:52620481-52620503 AACAAATTGTAGAAATTGAAAGG + Intergenic
1150030582 17:61730293-61730315 TACAGATTGTAGACATGTAGAGG - Intronic
1150073696 17:62174169-62174191 AACAGAATGTAGATAGGTAAAGG - Intergenic
1152159643 17:78659568-78659590 AACAGATTTTAGAAATGCTGAGG + Intergenic
1153793182 18:8598371-8598393 AAAAAATTGTAGAAATGGGCTGG + Intergenic
1156123079 18:33868441-33868463 AATAGAGTATATAAATGTGATGG - Intronic
1156624644 18:38893659-38893681 TACAGATGGTAGAAATGGGTGGG + Intergenic
1156719757 18:40055742-40055764 AACCATTTGTAGAAATGTCAAGG - Intergenic
1159123822 18:64200352-64200374 AAAAGGTTGTAGAAAAGAGATGG - Intergenic
1159812396 18:73031105-73031127 AACAGATTGTCAAAATGTGTGGG + Intergenic
1163855059 19:19695114-19695136 AACAGGTTGTAAAAAAATGAAGG - Intergenic
1164277175 19:23730248-23730270 AAAAGAAACTAGAAATGTGATGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165414849 19:35686555-35686577 AACAGCTTGTAAACATGTCAAGG + Intergenic
1166805257 19:45483015-45483037 AACAGGTTGTAGAAAGATGAAGG + Intergenic
1168450042 19:56459311-56459333 AACAGATAATAGAAGGGTGAGGG - Intronic
925217743 2:2111552-2111574 AACAGAGGCTAGAAATGTGAAGG + Intronic
925733134 2:6937080-6937102 AACAGGTACTAAAAATGTGAGGG + Intronic
925852300 2:8093988-8094010 ATCAAAATGTAGAAATGTTAGGG + Intergenic
925933464 2:8730622-8730644 AGCAAAATGTAGAAAGGTGATGG + Exonic
927449206 2:23192196-23192218 AACAAATTGTAAAAAAGTAAAGG + Intergenic
928763248 2:34609579-34609601 AACAGAAAGTAAAAAAGTGAGGG - Intergenic
929359808 2:41074257-41074279 AACATATGGCAGAAATGAGAGGG - Intergenic
930385879 2:50694248-50694270 AAAAGATTCCAGAAATTTGAGGG + Intronic
930521672 2:52475084-52475106 AACAAGTTATAGAAAGGTGAGGG - Intergenic
930932724 2:56907082-56907104 AGAATATTGTAGAAAAGTGATGG - Intergenic
931240922 2:60452024-60452046 AACAGATTTGAGAAATGGGCAGG - Intronic
931758746 2:65397576-65397598 AACAGATTGTAGAAATGTGAAGG - Intronic
932530274 2:72522933-72522955 GACAGTTTGTAGCAATGTGTTGG - Intronic
934154845 2:89187859-89187881 AACATAATGTAGAAATGTTCTGG - Intergenic
934212473 2:89994864-89994886 AACATAATGTAGAAATGTTCTGG + Intergenic
935451996 2:103220524-103220546 AACAGATTGAAGAAATTTGGAGG - Intergenic
935515677 2:104035449-104035471 AACAGAGAGTGGAAAGGTGATGG - Intergenic
940111485 2:150159845-150159867 AATAAATTGTAGAAATTTCAAGG + Intergenic
940459942 2:153952221-153952243 AACACTTTGTGGAAATTTGAGGG + Intronic
940511783 2:154624758-154624780 ACCAGAGAGTAGAAATATGAGGG + Intergenic
941029863 2:160498770-160498792 AACAGATTGTAGATCTTGGATGG - Intergenic
941306919 2:163881386-163881408 ATCAGATTTGAGAAAAGTGATGG + Intergenic
941542542 2:166804583-166804605 TAAAGATTTTAAAAATGTGAAGG - Intergenic
943150976 2:184112599-184112621 TACAGATTGTAGTAATGTGTGGG - Intergenic
944015107 2:195026597-195026619 AACAACTTGTTGAAATGAGAAGG - Intergenic
944935425 2:204562144-204562166 AATAGAATTTAGAAATCTGAGGG - Intronic
946918784 2:224555564-224555586 AACAGATTGTAGAAAAATTTGGG - Intronic
948500240 2:238387399-238387421 GTCAGATTGTAGAAATGGCATGG + Intronic
1169755179 20:9035814-9035836 ATCAGATAGTAGGAATGTGGTGG + Intergenic
1170192355 20:13656837-13656859 AACAGACTGTAAAAATGGAACGG - Intergenic
1170695793 20:18657439-18657461 GAAAGATTGCAGAAAAGTGATGG - Intronic
1172378923 20:34471898-34471920 ATCAGATTGTAGAAAGGAGAGGG + Intronic
1172594528 20:36141295-36141317 AAGACAAAGTAGAAATGTGAAGG + Intronic
1173358091 20:42314139-42314161 AAGAGCTTATAGAAATGTAAGGG - Intronic
1173631436 20:44519159-44519181 AATAGATGGTAGAAAAGTAAAGG - Intronic
1175210330 20:57350298-57350320 AACTGTCTGTAGAAATGTTAAGG - Intergenic
1176985012 21:15425696-15425718 AACAAATTGCAGAAAAGTGAGGG - Intergenic
1177499249 21:21930803-21930825 AAGAGATAATAGAAATTTGAAGG + Intergenic
1178074776 21:29004837-29004859 AATACAATGTAGAAATCTGAAGG - Exonic
1178464778 21:32837492-32837514 AACAGATGGGTGAAGTGTGAAGG - Intergenic
1180692740 22:17731010-17731032 AACAGCTATTAGAACTGTGAAGG - Intergenic
1181767279 22:25100885-25100907 AAAAGATTGAAAAAATGAGAAGG - Intronic
1182376012 22:29848691-29848713 AACACATTTTAGAAATCAGAGGG + Intergenic
1185122432 22:48980199-48980221 AACACATTGTAGAGCTGGGAGGG - Intergenic
949795811 3:7849533-7849555 AACAGTATGGAGAAATGTGATGG + Intergenic
949812581 3:8021619-8021641 AACTGATTTTAAAAATGTGGTGG - Intergenic
951115211 3:18853173-18853195 AACAGATTATAGCAAAGGGATGG - Intergenic
952445994 3:33381286-33381308 CACAGATTGGAGAAAGATGATGG - Intronic
952516941 3:34113950-34113972 AAAACATGGAAGAAATGTGAGGG - Intergenic
952793920 3:37222251-37222273 AACATATTATAGAAGTGAGATGG - Intergenic
953255738 3:41288874-41288896 AACCTAGTCTAGAAATGTGATGG + Intronic
953780253 3:45862605-45862627 AACAGATTGTAGAACCAGGAGGG - Intronic
955422472 3:58752361-58752383 AGCACATTGTAGAAATGTGCTGG - Intronic
955833876 3:63032363-63032385 AACAGATTTCACAAATCTGAGGG - Intergenic
956305617 3:67821198-67821220 AGCAGCTTGCAGAAAAGTGAAGG - Intergenic
956553228 3:70485737-70485759 AACATATTGTACTCATGTGATGG + Intergenic
957183075 3:76906780-76906802 AACATATTGGAGAAAAGGGATGG - Intronic
957508901 3:81161667-81161689 AACACTTTGTAGATGTGTGATGG + Intergenic
958560100 3:95737328-95737350 AGCAGAGTATAGAAAGGTGAAGG + Intergenic
961444053 3:126970473-126970495 AATAGATTGGGCAAATGTGAAGG - Intergenic
961503384 3:127353498-127353520 AAAAAATTTAAGAAATGTGAAGG + Intergenic
962180919 3:133205723-133205745 AAAAGAATGAAAAAATGTGAAGG - Intronic
964366378 3:155954897-155954919 AACAGATAGTAGCAAGGTTATGG - Intergenic
964582689 3:158258288-158258310 AAAATATTGTATAAATATGATGG - Intronic
965173895 3:165304851-165304873 GACAGATTATGGAATTGTGAAGG + Intergenic
965537954 3:169843610-169843632 AAAAGCTTATATAAATGTGAGGG - Intronic
965546649 3:169923142-169923164 AATAGATGGGAGCAATGTGAAGG + Intronic
966066160 3:175824744-175824766 ACCAGAATGTTGAAAAGTGAAGG + Intergenic
966189600 3:177260044-177260066 AAAAGATTGTAGTCATCTGAAGG + Intergenic
968035672 3:195545439-195545461 AATAGTTTGTAAAATTGTGAGGG + Intergenic
969355210 4:6621050-6621072 AGCAGATTGTAGACAGGTGCAGG + Intronic
970130460 4:12864129-12864151 AACATATTGCAGAAAAGAGAAGG - Intergenic
971015483 4:22484927-22484949 AGCAGAATTAAGAAATGTGAAGG - Intronic
971147852 4:23998446-23998468 AAGAAATTGTAGAAACATGATGG - Intergenic
971718924 4:30219164-30219186 AACAGAAAGTTGAAAAGTGAGGG - Intergenic
973229105 4:47821625-47821647 AACAAAATTTAAAAATGTGATGG - Intronic
974575542 4:63715437-63715459 AACAGATTGGAAGAGTGTGAAGG - Intergenic
974675447 4:65081978-65082000 GACATATGGTAGAAATGAGAGGG - Intergenic
975523064 4:75320845-75320867 AACAAATTGTAGGATTGTGAGGG + Intergenic
976353862 4:84091782-84091804 AACAGATGGGGAAAATGTGAGGG - Intergenic
976772816 4:88672744-88672766 AACAGATTGTGGAAATTAAATGG + Intronic
978442941 4:108753151-108753173 CACAGAATTTAGAAATGTTAAGG - Intronic
978818963 4:112943166-112943188 AACAGATTTAAGCAATGAGATGG + Intronic
979160635 4:117456582-117456604 AACACATTTGAGAAATGTGAAGG - Intergenic
979315489 4:119256769-119256791 AACAAATTTTAGAACTGTGAAGG + Intronic
980832041 4:138142283-138142305 AACAGCTTTTAGAGATGTTACGG - Intergenic
981209402 4:142084701-142084723 AAAATATTTTAGAAATGTGTGGG + Intronic
981624008 4:146736080-146736102 TCCAGTTTGGAGAAATGTGAAGG + Intronic
982623530 4:157734326-157734348 AACATATTGAAAATATGTGATGG + Intergenic
982991643 4:162284304-162284326 AAAAGAGTGTATAAATCTGATGG + Intergenic
983033349 4:162831078-162831100 AACAAATATTTGAAATGTGATGG + Intergenic
984065187 4:175038730-175038752 AAGAGAAAGGAGAAATGTGAGGG + Intergenic
984128429 4:175841606-175841628 AACACATTGCAGAAGTGTGCTGG - Intronic
984227876 4:177056739-177056761 AACAGAGTATATAAATGTCAGGG + Intergenic
984278861 4:177642976-177642998 ATTATATTGTATAAATGTGAAGG - Intergenic
986279085 5:6308247-6308269 AACAGATTGAAGAAATGGAGAGG + Intergenic
987042867 5:14079190-14079212 AAAAAATTGTATAAATGTAAGGG - Intergenic
987747895 5:22000668-22000690 TCCACATGGTAGAAATGTGAAGG - Intronic
987842808 5:23242453-23242475 AACTGATCGTAGGAATGAGAGGG - Intergenic
988252798 5:28782181-28782203 TACACATTATATAAATGTGATGG + Intergenic
988387312 5:30581809-30581831 AACACATTGGAGAAATCTCAGGG - Intergenic
989644024 5:43609833-43609855 GACAGTTTGTAGATATGAGATGG - Intronic
989693100 5:44169498-44169520 AAGAGAATGGAGAAAAGTGAGGG + Intergenic
990603601 5:57385302-57385324 CACAGAATGTAGAAGTGGGAGGG - Intergenic
990680770 5:58241849-58241871 TACACATTGAAGAAATGTGTGGG - Intergenic
991217438 5:64171792-64171814 AACAAATTTTAGGAATGAGAAGG - Intronic
992158408 5:73977252-73977274 AACAGATACTTTAAATGTGAAGG + Intergenic
992246808 5:74834116-74834138 AACAACTTTTGGAAATGTGAGGG + Intronic
993496124 5:88611108-88611130 TAGAGACTGGAGAAATGTGAGGG - Intergenic
993646621 5:90471222-90471244 AACAGGTTGTAGGAAGGTGGTGG - Intronic
994165325 5:96602301-96602323 AGCACATAGTAGAAATGTAAAGG - Intronic
995778708 5:115753482-115753504 TATAGTTTGTAGCAATGTGATGG + Intergenic
997325285 5:133015500-133015522 AACAGAATGAAGCAAGGTGAGGG + Intronic
999054763 5:148562526-148562548 AGCAGATTGGAGAGAAGTGAAGG - Intronic
1000198760 5:158987068-158987090 AACAGATCTGAGAAATATGAGGG + Intronic
1000397085 5:160787391-160787413 AACAGGTTGTAGGAAGGTTAGGG - Intronic
1000964520 5:167640071-167640093 GACAGATTGAAAAAAAGTGAAGG - Intronic
1001174228 5:169450455-169450477 GACAGATTGAAAAAATGAGATGG + Intergenic
1001974580 5:175987057-175987079 AACAGAGTAAAGAAAAGTGATGG + Intronic
1002242853 5:177856722-177856744 AACAGAGTAAAGAAAAGTGATGG - Intergenic
1003177152 6:3760914-3760936 TAGAGAATGTAGGAATGTGAGGG - Intergenic
1003218092 6:4133748-4133770 ATCAGGCTGCAGAAATGTGAGGG - Intronic
1003799832 6:9651318-9651340 AACAATTTGAAGAAATGTTAAGG - Intronic
1003985820 6:11434183-11434205 AACAGATTGTAATATTCTGAAGG + Intergenic
1004766360 6:18732221-18732243 AACAGTTTGGAGAGATCTGAAGG + Intergenic
1005142358 6:22647526-22647548 AACATATTCTAGCAATGGGATGG - Intergenic
1005284460 6:24310401-24310423 AACATATTGCTGAACTGTGATGG - Intronic
1005396613 6:25388835-25388857 AAAAAATTGTAAAAATGTGCTGG - Intronic
1006778253 6:36613393-36613415 AACGGAGCGTAGAGATGTGACGG + Intergenic
1007317619 6:41002171-41002193 GACAGATGGCAGAAATGTGGTGG - Intergenic
1007889893 6:45279152-45279174 AAAAGATTTTAGATATTTGAAGG - Intronic
1008544711 6:52574880-52574902 AACAAATGCTAGAAATATGACGG + Intronic
1009341524 6:62560502-62560524 ACCTGAGTGTAGAAATGGGAAGG - Intergenic
1009673219 6:66783967-66783989 AACAGATGGTTGAAATATTAAGG - Intergenic
1010082283 6:71877803-71877825 AACACATTGTACAAATTGGAAGG + Intergenic
1010714415 6:79211661-79211683 AACAGATACGACAAATGTGAGGG + Intronic
1012293046 6:97482460-97482482 AAATCATTGTACAAATGTGAAGG + Intergenic
1014230180 6:118894456-118894478 AACGGGTTGTAGAAAGGAGAAGG - Exonic
1014722091 6:124929283-124929305 ACCACATTGTAGAACTGGGATGG - Intergenic
1017584621 6:155907049-155907071 CACACAATGTATAAATGTGAGGG - Intergenic
1018539510 6:164863385-164863407 TACAGACTGTAGAACTGGGAAGG - Intergenic
1018658345 6:166062053-166062075 AACAGAATTTAGAGATCTGAAGG - Intergenic
1018842556 6:167528288-167528310 AAAAGATCTTAGAAATGAGATGG - Intergenic
1018959314 6:168435921-168435943 AATAGATGGTTGGAATGTGATGG - Intergenic
1020203849 7:6100630-6100652 AACAGAGTGTAAAAATGTCCAGG - Intergenic
1020623079 7:10541918-10541940 AACAGATTAAAGAGATGGGAAGG + Intergenic
1021236986 7:18154111-18154133 ATCATTTTATAGAAATGTGAAGG - Intronic
1024382522 7:48714117-48714139 AACAGATTGAAAAAATATGAAGG - Intergenic
1026402472 7:70028668-70028690 AAAATATTGAAGAGATGTGAGGG - Intronic
1027624955 7:80533337-80533359 AACAGGTTGTAAGAATGTGGAGG + Intronic
1028568985 7:92265577-92265599 AATAGATTGTAGTGATGAGAGGG + Intronic
1028573220 7:92315838-92315860 AACTAATTTGAGAAATGTGAAGG + Intronic
1028978502 7:96940594-96940616 AAGAGATTGTAGACATGGGAGGG - Intergenic
1030283714 7:107803536-107803558 AACAGGTTGGTGAAATGTCAAGG - Intergenic
1030454025 7:109749775-109749797 AGCAAAATGTAAAAATGTGATGG - Intergenic
1031273865 7:119692719-119692741 ATCATATTATAGAAATGTGAAGG - Intergenic
1031496670 7:122457765-122457787 CACAGCTTTTAGATATGTGAGGG + Intronic
1032822935 7:135541282-135541304 AAAAGACTGGAGAAATGTCAAGG + Intergenic
1033690528 7:143732166-143732188 AACAATCTGTAGAAATGAGAAGG - Intergenic
1034247353 7:149657120-149657142 GACAGAAAGTAGATATGTGATGG + Intergenic
1034717990 7:153261421-153261443 ACCAAATTTTAAAAATGTGAAGG - Intergenic
1035782671 8:2240815-2240837 AGCTGATTATAAAAATGTGAAGG - Intergenic
1035809452 8:2478774-2478796 AGCTGATTATAAAAATGTGAAGG + Intergenic
1036594883 8:10202432-10202454 ATCACAGTGTAGAAATGAGAAGG + Intronic
1039648284 8:39311416-39311438 AATATATTCTAGAAATGTGGTGG + Intergenic
1039715155 8:40100171-40100193 AACAGATAGAAGATAAGTGAAGG - Intergenic
1040642199 8:49349085-49349107 AAATGATGGTAGAAATGAGATGG - Intergenic
1040646062 8:49398718-49398740 ATCATATTGAAGAAATGTCATGG + Intergenic
1041228704 8:55727943-55727965 AACAGATTGCTGAAAATTGAGGG + Intronic
1043870697 8:85428371-85428393 CACAGACTGTAGAAAAGTGTTGG + Intronic
1044042933 8:87392194-87392216 CATAGCTTGTGGAAATGTGAAGG + Intronic
1045711962 8:104995361-104995383 AATAGATTGTAGAAATAGGCAGG - Intronic
1045963371 8:107995510-107995532 GACACTTTGAAGAAATGTGACGG - Intronic
1046100857 8:109612599-109612621 AGCAGATTGAATCAATGTGATGG - Intronic
1046213976 8:111117582-111117604 AATAGATTGGAGAAATTTTAAGG + Intergenic
1046530879 8:115443442-115443464 AGCAGATTGTGCAAATGTCAAGG - Intronic
1046624610 8:116563220-116563242 AACAGGTTGTCCGAATGTGAAGG - Intergenic
1046787621 8:118285044-118285066 AACAGAGTATAAAAATGAGAGGG - Intronic
1046892060 8:119432996-119433018 GACATTTTGTAGAGATGTGAAGG - Intergenic
1047219808 8:122910344-122910366 AATTCATTGTAGAATTGTGATGG + Intronic
1047294029 8:123555359-123555381 AACGGATTGGAGAGAAGTGAAGG - Intergenic
1048202271 8:132384371-132384393 AACATCTTGAAGTAATGTGATGG + Intronic
1049281738 8:141753018-141753040 AGCTGGTTGAAGAAATGTGAGGG + Intergenic
1050478415 9:6064619-6064641 AACAGATTGAAGAGAGATGAAGG + Intergenic
1051395761 9:16618386-16618408 AACAGATTCTGGTAATGAGAAGG - Intronic
1052404616 9:28043891-28043913 AACACAATGTAAAAATGTCAGGG - Intronic
1053672391 9:40380451-40380473 AACAGATTTTGGCAATGTGGTGG + Intergenic
1054383506 9:64520480-64520502 AACAGATTTTGGCAATGTGGTGG + Intergenic
1054512233 9:65995858-65995880 AACAGATTTTGGCAATGTGGTGG - Intergenic
1055917514 9:81420917-81420939 AACAGATTGCAGGAAGGCGAGGG - Intergenic
1058749406 9:108024127-108024149 ACCTGATTGTACAAAAGTGATGG - Intergenic
1058990123 9:110247459-110247481 AACAGATTGCATATATGTGGTGG + Intronic
1061851197 9:133416930-133416952 AGCAGATAGCAGACATGTGATGG - Intronic
1191127534 X:56973741-56973763 AGCCAATTGGAGAAATGTGAGGG + Intergenic
1192324452 X:70120638-70120660 GACAGAATGTAGAATTGTGTAGG + Intergenic
1192413953 X:70960616-70960638 AACAGACTGGAGAGATGGGAAGG + Intergenic
1192640844 X:72860308-72860330 CACAGATTATAGACCTGTGATGG - Intergenic
1193604936 X:83554792-83554814 AACAGATATAAGAAATCTGAAGG + Intergenic
1194622658 X:96192226-96192248 ATCAGAGTGCAGAAATGTGTGGG - Intergenic
1194633209 X:96312097-96312119 AGGAGATTAGAGAAATGTGAAGG + Intergenic
1194779455 X:98006385-98006407 CTCAGATTGCAGAAGTGTGAAGG + Intergenic
1194932914 X:99910413-99910435 ACCTGATTGTAGAAATTTGGTGG + Intergenic
1195860993 X:109382926-109382948 GACAGTTTTTAGAAATGTCAAGG - Intronic
1196504240 X:116422543-116422565 AACAGAGTGTAGCAATTTCAGGG - Intergenic
1197410864 X:126114799-126114821 ACCAGAGGGTAGAAATGTTAGGG - Intergenic
1199361691 X:146927744-146927766 AACATTTTCTAGAAATGAGAGGG - Intergenic
1200325817 X:155237649-155237671 AACAAAGTGTAGAAATGCAAAGG - Intronic
1201965921 Y:19735586-19735608 AACAGATTGGGGAAGTGTGAGGG - Intronic