ID: 931761395

View in Genome Browser
Species Human (GRCh38)
Location 2:65420294-65420316
Sequence AACACGGAGGTGGGTACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761395_931761402 -3 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761402 2:65420314-65420336 GTTGGAGTTATTGACAGCACAGG 0: 1
1: 0
2: 2
3: 5
4: 103
931761395_931761404 24 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761395_931761406 26 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761395_931761407 27 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761395_931761408 28 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761395_931761405 25 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761395 Original CRISPR AACACGGAGGTGGGTACAAT GGG (reversed) Intronic
902978576 1:20107307-20107329 AAAACGAAGGTGGGTATGATTGG - Intergenic
906201334 1:43962293-43962315 GCCACGGAGGTGGGTAGAAGTGG - Intronic
911842850 1:102706383-102706405 AACACGGAAGTGGGTTCATTAGG + Intergenic
914940120 1:152015045-152015067 AACACAGAGATGAGTAAAATAGG + Intergenic
920193794 1:204212867-204212889 AACAAGGAGGTGGGTATACCTGG - Intronic
923366495 1:233266936-233266958 CAGACAGAGGTGGGTCCAATGGG - Intronic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1067043848 10:42973627-42973649 AAGAGGGAGGTGCGTACAAGCGG - Intergenic
1071613996 10:87057707-87057729 AACTCTGCCGTGGGTACAATGGG + Exonic
1075540892 10:123312896-123312918 AACAAAGAAGTGGGTTCAATAGG + Intergenic
1078503584 11:11910258-11910280 AACACGGTGGTGAGTTCCATGGG + Intronic
1083036043 11:59638566-59638588 AACACTGAACTGGGTACAACAGG - Intronic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1086960686 11:92977637-92977659 AACAAGGTGGTGGGAACAGTGGG - Intronic
1087116721 11:94533394-94533416 AACAAGGTGGTGGCTAGAATTGG - Intergenic
1091599641 12:1909978-1910000 AACACAGAGGTAGGGAGAATGGG + Intronic
1093150763 12:15618360-15618382 ATCACAGAGGTGGTTATAATAGG - Intergenic
1096165509 12:49420152-49420174 AACACGTAGATGGGTAGAAAAGG + Intronic
1098900733 12:76109530-76109552 AACACTTTGGTGGGTAGAATTGG + Intergenic
1107088776 13:36453400-36453422 AGCACTGAGGTGGGTGCTATAGG - Intergenic
1108795849 13:54029653-54029675 AACACGCAGGTGAATACAAATGG - Intergenic
1113556943 13:111244319-111244341 AACACTCAGGTTGGTATAATTGG + Intronic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1118380427 14:65213544-65213566 CACAGGGAGGAGGGTATAATGGG + Intergenic
1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG + Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG + Intronic
1141001559 16:80313017-80313039 AACAAGGATGTGGGTGCAAGTGG + Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1163198472 19:15743424-15743446 AAAAAGGAGGTTGGTAAAATAGG + Intergenic
929083791 2:38148067-38148089 ATCACGAAGATGGGAACAATAGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
933663566 2:84946614-84946636 ACCACGGAGGTGAGTGCAAGTGG - Intergenic
941838462 2:170052677-170052699 GACAGGGAGGTGGGGAAAATGGG + Intronic
944985556 2:205171630-205171652 AACACAGAGGTGTGTAGAAAAGG - Intronic
946138445 2:217667444-217667466 AACAAGAAGGTGGGGACAAAGGG + Intronic
946616182 2:221513131-221513153 AACACTGAGGTGGGTACTGTGGG + Intronic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1179357847 21:40677846-40677868 ATCAAGGAGGTGGGTAGATTTGG - Intronic
1181754090 22:25010693-25010715 AACACGGAGCTTGGCACAAATGG - Intronic
1184441994 22:44522758-44522780 AGCACAGAGGTGGGGACATTTGG - Intergenic
952136120 3:30422576-30422598 AACACGGAAGTGGTGATAATGGG + Intergenic
952962003 3:38598186-38598208 AAGATGGAGGTGGGGAAAATGGG + Intronic
953886111 3:46715198-46715220 AACAAGGATGTGGGTGCAAAGGG + Intronic
954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG + Intronic
963383041 3:144556112-144556134 AACACTGTTATGGGTACAATGGG + Intergenic
966204005 3:177387470-177387492 AACACCAATGTGGGTATAATCGG + Intergenic
981461060 4:145014167-145014189 AGCTCGGAGGTGGGTACCATGGG + Intronic
983399458 4:167244730-167244752 AACAGGGAGGTGAGTTCACTGGG - Intergenic
992661083 5:78961534-78961556 AACACGGAACTGAGGACAATAGG - Intronic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1019940563 7:4285974-4285996 AAAACTGAGGTGAGCACAATTGG + Intergenic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1032634579 7:133692944-133692966 AACAAGGAGGAGGATACAACAGG - Intronic
1042452527 8:68965376-68965398 AACAAGGAGGTGAGTAGAAGCGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1051504741 9:17814550-17814572 GACACAGAGATGGGAACAATAGG + Intergenic
1057766118 9:97920940-97920962 AACAGGGAGGTGGGAACCTTTGG - Intronic
1062576747 9:137212396-137212418 AACAGGCAGGTGGGTAGGATGGG - Intronic
1188286943 X:28338833-28338855 AACACGTTGCTGGGTACATTAGG - Intergenic
1192036645 X:67569876-67569898 CACATGGAGATGGGGACAATAGG - Intronic
1196965411 X:121049140-121049162 AACTCTGCCGTGGGTACAATGGG - Exonic
1198672712 X:139098692-139098714 AACACAGAGATGGGAACAATAGG + Intronic