ID: 931761402

View in Genome Browser
Species Human (GRCh38)
Location 2:65420314-65420336
Sequence GTTGGAGTTATTGACAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761396_931761402 -4 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761402 2:65420314-65420336 GTTGGAGTTATTGACAGCACAGG 0: 1
1: 0
2: 2
3: 5
4: 103
931761395_931761402 -3 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761402 2:65420314-65420336 GTTGGAGTTATTGACAGCACAGG 0: 1
1: 0
2: 2
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761402 Original CRISPR GTTGGAGTTATTGACAGCAC AGG Intronic
901228335 1:7627907-7627929 GTGGGGGTTATTGACACCAGAGG + Intronic
903844676 1:26271608-26271630 GTTGTTGTTATTTACAGCTCTGG - Intronic
905112379 1:35605312-35605334 GTTGGATATAATGACAGCACCGG - Intronic
906867384 1:49437125-49437147 GTTGGAGTTGAGGACAGCCCGGG + Intronic
907237168 1:53060775-53060797 GTTGGTGTGATTCACAGCATTGG - Intergenic
910469004 1:87530685-87530707 CTTGAAGTTCTTGACAGCTCTGG + Intergenic
911510755 1:98805690-98805712 TTTTAAGTTCTTGACAGCACAGG + Intergenic
911739381 1:101370283-101370305 GTTGGACACATTGATAGCACAGG + Intergenic
915558277 1:156672177-156672199 CTTAGAGTCATTGACAGCTCTGG - Exonic
922939840 1:229453077-229453099 GCTGGGATTTTTGACAGCACGGG - Intronic
924409304 1:243786662-243786684 CTTGAAGTTATTAAAAGCACGGG + Intronic
924456899 1:244225987-244226009 GTGGGAGATGTTGACAACACAGG + Intergenic
1063507261 10:6611287-6611309 GTTGGAGTTATTAAGAGCTTGGG - Intergenic
1063731702 10:8704894-8704916 ATTGTAGTGATTGAGAGCACAGG + Intergenic
1070290924 10:75112607-75112629 TTTGGATTTATTGACAGTAATGG + Intronic
1075941984 10:126397721-126397743 GTTGGAGATATTGCCAACAATGG + Intergenic
1076396967 10:130146159-130146181 GCTGGAGTTTTGGAGAGCACAGG + Intronic
1079835692 11:25329622-25329644 GTTGGAGTCATTCACTGCAAGGG - Intergenic
1084769969 11:71336299-71336321 GGTGGAATTATTGATGGCACTGG - Intergenic
1088456745 11:110040844-110040866 GATGGAGCAATTGACAGCAAAGG + Intergenic
1093442157 12:19211768-19211790 GTTGGTTTTATTGACAGAAAAGG + Intronic
1096096702 12:48940194-48940216 GTTGGTGTTATGGCCACCACTGG - Intronic
1099187140 12:79527799-79527821 GATGCATTTATTGACACCACAGG + Intergenic
1101537819 12:105635745-105635767 GATGGAGATGTTGACACCACAGG - Intergenic
1103969394 12:124660628-124660650 GATGGAGGTAGTGCCAGCACCGG - Intergenic
1105645112 13:22309572-22309594 GTTGGTGTTATTGAAAGCACAGG + Intergenic
1113148120 13:107231446-107231468 GTTACAATTATTCACAGCACGGG - Intronic
1113604436 13:111595355-111595377 ACTGGAGTGAGTGACAGCACTGG + Intronic
1114646345 14:24258627-24258649 GTTGAAGTTGGTGACAGTACGGG + Exonic
1119430494 14:74565167-74565189 GTTGGAGTTTTTGCCATCCCTGG - Intronic
1120687943 14:87560193-87560215 ATTGGACTTGTTGACAGGACTGG + Intergenic
1121421855 14:93821556-93821578 GTTGGAATTATGGGCAGAACAGG - Intergenic
1122213593 14:100188879-100188901 GCTGGAATTAGTTACAGCACTGG + Intergenic
1130727500 15:86454730-86454752 GTTGGGGCTATTGACTGCAAAGG + Intronic
1131518191 15:93093448-93093470 GGTGGAGATATTGACTGCAAGGG + Intergenic
1133676695 16:8079973-8079995 GTTGCAGGTATTGACTGAACTGG + Intergenic
1137478308 16:48829925-48829947 GTTGGAGTTGTTGACGGCAATGG + Intergenic
1139256313 16:65546356-65546378 ATTAGAGTTAATGCCAGCACAGG + Intergenic
1139256753 16:65549907-65549929 ATTAGAGTTAGTGCCAGCACAGG - Intergenic
1142558130 17:793516-793538 GTTGGAGTTGAAGACAACACAGG + Intergenic
1149588794 17:57811952-57811974 CCTGGAGTTGTTCACAGCACGGG - Intergenic
1153961092 18:10140784-10140806 GTTAGAGTTATTCAGAGCAAAGG - Intergenic
1159229021 18:65580639-65580661 GTTGGAGTTGTTGCCAGCTTTGG - Intergenic
1165760216 19:38316559-38316581 GTTTGGGTCATTGAGAGCACTGG + Intronic
1167797058 19:51716421-51716443 GTTGGTGTTGGTGACAGCAGAGG - Intronic
930575153 2:53137986-53138008 GTTTGAATTTTTGAAAGCACAGG + Intergenic
931761402 2:65420314-65420336 GTTGGAGTTATTGACAGCACAGG + Intronic
932354624 2:71058746-71058768 ATTGGAGTTGTTGACACAACGGG - Intergenic
940183270 2:150957358-150957380 GTTGGAGTCATTCACTGCAAGGG + Intergenic
940508525 2:154584936-154584958 GTTGGAGTCATTCACTGCAAGGG - Intergenic
940527293 2:154832653-154832675 CTTGGAGTTATTAACATCAGAGG + Intronic
942298400 2:174538859-174538881 GTTCCAGTTATTGAAAGCATGGG + Intergenic
946367723 2:219260081-219260103 GTTGGTTTTGATGACAGCACCGG + Intronic
946871426 2:224089046-224089068 GCTGGAGTCATTGACAGCAAGGG - Intergenic
947990208 2:234481261-234481283 GTGGGAGAGATTGACAGCAGTGG - Intergenic
1171141419 20:22747084-22747106 CTGGGAGGTATTCACAGCACAGG - Intergenic
1173235965 20:41245661-41245683 GTTGGAATTATATATAGCACAGG - Intronic
1176978051 21:15346646-15346668 GTTGTAGTTAATGAGAGCCCTGG - Intergenic
1178248828 21:30981675-30981697 GTGGGAGTTATTGAAAGCCCAGG + Intergenic
1181851223 22:25751339-25751361 TTTGGTGTTAGTCACAGCACAGG - Intronic
1184514857 22:44955692-44955714 TTTGGACTGAATGACAGCACCGG + Intronic
951126030 3:18984286-18984308 GTTGGTGCTATTAGCAGCACTGG + Intergenic
955327518 3:58020749-58020771 GTTGGAGTTATTTGGAACACAGG + Intronic
956101157 3:65769913-65769935 GTTGGAGGTTTTGACAGGAGAGG - Intronic
956680121 3:71771151-71771173 TTTGTAGTTATTGACAGCCAGGG - Intergenic
956850342 3:73223139-73223161 GTGGCAGATATTGCCAGCACTGG - Intergenic
958595748 3:96219443-96219465 GTTGAAACTATTGACAGAACTGG + Intergenic
967760561 3:193220433-193220455 GGTGGAGGTAATGACAACACTGG + Intergenic
970629180 4:17922857-17922879 GTTGGGGATGTTGACACCACTGG - Intronic
976360693 4:84174652-84174674 GTTTGAGTTGTTGAAAGTACTGG + Intergenic
979975936 4:127196604-127196626 TTAGGAGTTATTCCCAGCACTGG - Intergenic
980273324 4:130615514-130615536 TTTGGGGTTATTTATAGCACTGG - Intergenic
981482604 4:145254219-145254241 GTTGGAGTCATTCACTGCAAGGG - Intergenic
983024424 4:162715507-162715529 TTTGGAATTATTGATAGAACAGG + Intergenic
983220584 4:165040072-165040094 GATGGAGTTTGTGACAGCCCTGG + Exonic
990074999 5:51833122-51833144 GTTGGAAAAAGTGACAGCACTGG + Intergenic
990867656 5:60397963-60397985 CTTACAGTTATTCACAGCACAGG + Intronic
997071298 5:130625711-130625733 GCTGAAGTTATTGATAACACCGG - Intergenic
997794450 5:136794759-136794781 GCTGAAGTTAATGGCAGCACAGG + Intergenic
1007693741 6:43718800-43718822 GGTGGAGTCAGTGAGAGCACTGG + Intergenic
1009308536 6:62121565-62121587 GTTGGTGTTATCGACAGGAATGG - Intronic
1011565141 6:88665540-88665562 GTTGGGGTTATTGCCAGCTAAGG + Intronic
1015213609 6:130724315-130724337 GGTGGAAATATTGACACCACAGG + Intergenic
1018355391 6:163009731-163009753 GATGGAGTTATTTACACCTCTGG + Intronic
1020992006 7:15209829-15209851 GTTGGAATTGTTGCCAGAACAGG - Intronic
1021317130 7:19162055-19162077 GTTGGAAGTGTTGACCGCACTGG - Intergenic
1027946847 7:84758247-84758269 GCTTGAGTTAGAGACAGCACAGG + Intergenic
1031305077 7:120115766-120115788 GTTGGAGTGCTTGAAAGAACAGG - Intergenic
1032612372 7:133429073-133429095 ATTGAGGTGATTGACAGCACGGG + Intronic
1032741544 7:134744545-134744567 GTTGGACATATTGAAAGCAGAGG + Intronic
1035952069 8:4032929-4032951 GTTGGAATTACTGATAGAACAGG + Intronic
1038944631 8:32344760-32344782 TTTGGAGTTTTCTACAGCACTGG - Intronic
1039779037 8:40765656-40765678 CTTGCGGTTATTGGCAGCACCGG + Intronic
1040648336 8:49424046-49424068 GCTGGAGTCATTGACTGCAAGGG + Intergenic
1042136158 8:65634968-65634990 ATTGGGGTTATTGACTGCAATGG - Intergenic
1042686675 8:71449567-71449589 GTTCCATTTATAGACAGCACAGG + Intronic
1043505020 8:80893943-80893965 GTTCGAGTAACTGACAGCTCCGG - Intergenic
1052349941 9:27448136-27448158 GTTGGAGTCATTGACAGCATGGG + Intronic
1052801259 9:32970288-32970310 GTTGGAGTTGTTGGAAGCAGAGG + Intergenic
1055558948 9:77503421-77503443 GTTGAAGTTTTTGAAATCACTGG - Intronic
1056001597 9:82223064-82223086 GTTGGAGTGGATGGCAGCACTGG + Intergenic
1056806231 9:89731030-89731052 GATGGAGTTATTGACACAACCGG - Intergenic
1187047876 X:15665855-15665877 GTTGAAGTCATTGGCAGCAATGG + Intergenic
1194978834 X:100419626-100419648 GTTGTAGTTATTAAGGGCACAGG + Intergenic
1196794779 X:119493337-119493359 GCTAGAGTTATTGACAACAATGG - Intergenic
1200742608 Y:6870387-6870409 GTAGAATTCATTGACAGCACTGG - Intronic
1201296612 Y:12468850-12468872 GTTGGTGTTATTTTCATCACAGG - Intergenic
1202276334 Y:23124388-23124410 GTTCTAGTGTTTGACAGCACAGG + Intergenic
1202289694 Y:23296302-23296324 GTTCTAGTGTTTGACAGCACAGG - Intergenic
1202429328 Y:24758113-24758135 GTTCTAGTGTTTGACAGCACAGG + Intergenic
1202441463 Y:24911977-24911999 GTTCTAGTGTTTGACAGCACAGG - Intergenic