ID: 931761404

View in Genome Browser
Species Human (GRCh38)
Location 2:65420341-65420363
Sequence CGTATTTTTAGTACCCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761396_931761404 23 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761399_931761404 14 Left 931761399 2:65420304-65420326 CCACCTCCGTGTTGGAGTTATTG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761401_931761404 8 Left 931761401 2:65420310-65420332 CCGTGTTGGAGTTATTGACAGCA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761398_931761404 15 Left 931761398 2:65420303-65420325 CCCACCTCCGTGTTGGAGTTATT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761395_931761404 24 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67
931761400_931761404 11 Left 931761400 2:65420307-65420329 CCTCCGTGTTGGAGTTATTGACA 0: 1
1: 0
2: 0
3: 2
4: 90
Right 931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761404 Original CRISPR CGTATTTTTAGTACCCCTTT TGG Intronic
908065016 1:60393416-60393438 CGAAATTTTAGTTCCACTTTGGG + Intergenic
908440368 1:64147615-64147637 CCTATTTTTATAACTCCTTTGGG + Intronic
908867168 1:68562158-68562180 CATATTTTTAGTTCGCCTTGTGG + Intergenic
920522575 1:206639245-206639267 CCTATTTTTCGTCCCCTTTTTGG + Intronic
921640910 1:217552591-217552613 CCTATTTTTGGAACCCCTTTGGG - Intronic
1066295479 10:34050536-34050558 CTTATTGTTTCTACCCCTTTTGG - Intergenic
1066650497 10:37650609-37650631 TGTATTTTTAGTGTCCATTTAGG - Intergenic
1068208327 10:53886898-53886920 CTTATTTTTATTGCCCATTTTGG + Intronic
1074947118 10:118291093-118291115 TGTATTTTTAGTAAGCCTATAGG - Intergenic
1078971152 11:16413188-16413210 CGTGTTTTTTGTCCCCCTTTTGG - Intronic
1089860980 11:121589875-121589897 TGTATTTTTTGTTCCCCATTGGG + Intronic
1091823603 12:3493340-3493362 GCTATTTTTAGAAACCCTTTCGG - Intronic
1095750015 12:45699406-45699428 TCTATTTTAAGAACCCCTTTTGG - Intergenic
1107915119 13:45141887-45141909 GGTATTTTTCTAACCCCTTTAGG + Intronic
1108122073 13:47199774-47199796 TGTTTTTTAAGTATCCCTTTTGG - Intergenic
1109034522 13:57238263-57238285 CTAATTTTTAGTATGCCTTTAGG - Intergenic
1109100034 13:58171928-58171950 TGTATTTTTAGTACCAACTTCGG - Intergenic
1110789242 13:79569131-79569153 GGTATCTTTAGTACACTTTTTGG + Intergenic
1116586542 14:46711951-46711973 CGTATTTTTAATACAAATTTAGG - Intergenic
1116745220 14:48809649-48809671 AATATTTTTCCTACCCCTTTAGG + Intergenic
1118664713 14:68055296-68055318 CCTATTTTTAGAACCAGTTTTGG + Intronic
1119793459 14:77375399-77375421 CATGTTTTTACTTCCCCTTTAGG - Intronic
1120362336 14:83521015-83521037 TGAATTTTTAGTACCACTGTCGG - Intergenic
1120839408 14:89071047-89071069 CATATTTTCAGTAACACTTTGGG - Intergenic
1121362956 14:93278855-93278877 TGAATTTTTGGTACCCCATTTGG + Intronic
1122160990 14:99783782-99783804 CTCATTAATAGTACCCCTTTGGG - Intronic
1131698229 15:94903509-94903531 GGGATTTTCACTACCCCTTTAGG - Intergenic
1140439037 16:74972645-74972667 TGTATTTTTAGTAGCCATGTTGG - Intronic
1144341168 17:14311384-14311406 CGTATTTTTAGAGCCGTTTTAGG + Intronic
1149705881 17:58694319-58694341 CATATTTTTACTATCCCTTTTGG - Intronic
1151260820 17:72914692-72914714 TGTATTTTTAGTAGCCATGTTGG - Intronic
1153467456 18:5404845-5404867 CCTATTTCTACTACCTCTTTTGG - Intronic
1157008321 18:43613818-43613840 CTTATATTTAGAACCCCTATAGG - Intergenic
1160041297 18:75347949-75347971 CTTGTTTTTAATAGCCCTTTGGG - Intergenic
1165329130 19:35131654-35131676 CGTATTTTTCTTACCACTATGGG - Intronic
926902089 2:17763004-17763026 TCTATTTTTAGTCTCCCTTTGGG + Intronic
928809443 2:35204780-35204802 CTTATTTTTAGCACCTTTTTTGG - Intergenic
931590428 2:63876946-63876968 AGTATATTTAGTATACCTTTTGG + Intronic
931761404 2:65420341-65420363 CGTATTTTTAGTACCCCTTTTGG + Intronic
940879912 2:158936232-158936254 CATATTTTCTGAACCCCTTTGGG + Intergenic
941764245 2:169279136-169279158 AGTATTTTTAGTACACCACTAGG + Intronic
1169314370 20:4576237-4576259 CATATTTTGAGTAGCCCTATGGG - Intergenic
952208088 3:31200511-31200533 CAGAATTTTAATACCCCTTTTGG - Intergenic
956457178 3:69433745-69433767 ATAATTTTTAGTACCCCTTTAGG + Intronic
959405013 3:105950997-105951019 CTTATTTTTAGCTCTCCTTTTGG + Intergenic
963394302 3:144712880-144712902 CCTATTTTTATTTCTCCTTTAGG + Intergenic
963927557 3:150967109-150967131 CGTTTATTAAGTACCTCTTTGGG + Intronic
977550115 4:98432866-98432888 TTTATTTCTAGTACCCTTTTTGG - Intronic
981164803 4:141545106-141545128 CTTATTTTTATTACCCATTAAGG + Intergenic
981773761 4:148340848-148340870 AGTATTTTTCATACACCTTTTGG - Intronic
986053970 5:4117678-4117700 AGTAATTTTATTAACCCTTTCGG + Intergenic
987328317 5:16832643-16832665 CTTAATTTTAGAACCCCTTTTGG + Intronic
990720576 5:58691188-58691210 TGTACTTTTAGTAGCCCTATGGG - Intronic
994807446 5:104468706-104468728 CTTAGTTTTAGTACCAGTTTTGG + Intergenic
1000419017 5:161015676-161015698 CATATTATTAGTACTTCTTTTGG + Intergenic
1015518642 6:134110137-134110159 TGTATTTTTAGTAGCACTTTGGG + Intergenic
1016261626 6:142177982-142178004 CGTTTTCTTTGTACTCCTTTTGG - Intronic
1018162315 6:161057503-161057525 CGTATTTTTAAAAGCCCTCTAGG - Intronic
1022622109 7:31995221-31995243 TGTAATTTTAGGAACCCTTTGGG - Intronic
1025807226 7:64845743-64845765 CGTGTTTTTAGCACACTTTTCGG + Intergenic
1029790143 7:102834340-102834362 AGTATCTTTAGTAACCCATTAGG - Intronic
1031872116 7:127099326-127099348 TTTATTTTTATTTCCCCTTTTGG - Intronic
1032644141 7:133802670-133802692 TGTATTTTTAGTAGCCATGTTGG - Intronic
1040332335 8:46392489-46392511 CTTAATTTTAGTCACCCTTTTGG - Intergenic
1042012981 8:64270335-64270357 TGTATTTTTAGTAAGCCTTTGGG + Intergenic
1042192816 8:66205205-66205227 CATATTTGTAGTTCCCTTTTTGG - Intergenic
1042385389 8:68167870-68167892 CATATTTTAAGAACCACTTTAGG - Intronic
1053107953 9:35429324-35429346 GGTATTTTTATTTCACCTTTTGG - Intergenic
1055322047 9:75091670-75091692 TGTATTTTTAGAAGTCCTTTTGG - Intronic
1055483093 9:76729256-76729278 CGTATTTTTAGAAGCCCTGTAGG - Intronic
1058475410 9:105327944-105327966 CGTATCTTTAGTACTTATTTAGG + Intronic
1059689116 9:116667746-116667768 ACTATTTTTAGAACACCTTTAGG + Intronic
1187372477 X:18721694-18721716 CTTATTTTTATTACCCCATGTGG + Intronic
1194814161 X:98422476-98422498 CTTCTTTTTGGTTCCCCTTTAGG - Intergenic
1197489340 X:127098430-127098452 CATATTTTTGGTACCATTTTTGG + Intergenic
1198512934 X:137372479-137372501 AGTCTTTTCAGGACCCCTTTGGG + Intergenic