ID: 931761405

View in Genome Browser
Species Human (GRCh38)
Location 2:65420342-65420364
Sequence GTATTTTTAGTACCCCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761396_931761405 24 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187
931761398_931761405 16 Left 931761398 2:65420303-65420325 CCCACCTCCGTGTTGGAGTTATT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187
931761400_931761405 12 Left 931761400 2:65420307-65420329 CCTCCGTGTTGGAGTTATTGACA 0: 1
1: 0
2: 0
3: 2
4: 90
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187
931761399_931761405 15 Left 931761399 2:65420304-65420326 CCACCTCCGTGTTGGAGTTATTG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187
931761395_931761405 25 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187
931761401_931761405 9 Left 931761401 2:65420310-65420332 CCGTGTTGGAGTTATTGACAGCA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG 0: 1
1: 0
2: 0
3: 22
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761405 Original CRISPR GTATTTTTAGTACCCCTTTT GGG Intronic
900334863 1:2157590-2157612 GTATTTTTAGTACTCTGTGTTGG + Intronic
911586498 1:99697059-99697081 GTATGTTTAGTGCTCATTTTAGG + Intergenic
912223892 1:107709167-107709189 GTACTTTTAGTGCTACTTTTAGG - Intronic
914759409 1:150586354-150586376 GTATTTTTAGTTCACCATATTGG - Intergenic
914773875 1:150718048-150718070 GTATTTTAAAAACACCTTTTTGG + Intronic
916431456 1:164733096-164733118 GTATTTTTATTCTCCCTATTGGG + Intronic
916513423 1:165493661-165493683 GTGTTTCTAATAGCCCTTTTGGG - Intergenic
917473875 1:175351484-175351506 CGATTTTTAATACCCCTTGTAGG - Intronic
918986503 1:191634834-191634856 GTATTTTTAGTACACCATGTTGG - Intergenic
919543823 1:198886360-198886382 TTATTTTTTGTCCTCCTTTTTGG - Intergenic
920863491 1:209731577-209731599 CTATTATTAATACCCTTTTTAGG - Intronic
921350089 1:214225821-214225843 GTATTTTTAGTAGACCATGTTGG - Intergenic
921640909 1:217552590-217552612 CTATTTTTGGAACCCCTTTGGGG - Intronic
1063223884 10:3996080-3996102 GTATTTTTATTTCCAATTTTTGG + Intergenic
1064239822 10:13616285-13616307 GTAATTTTCGTCCACCTTTTGGG - Intronic
1064776163 10:18779721-18779743 GTATTTTTAATCCACGTTTTAGG + Intergenic
1065302808 10:24339190-24339212 GTTTTTTAAATATCCCTTTTTGG + Intronic
1065890951 10:30120562-30120584 GAATATTTATCACCCCTTTTTGG - Intergenic
1066295478 10:34050535-34050557 TTATTGTTTCTACCCCTTTTGGG - Intergenic
1066812865 10:39363908-39363930 GGATATTTAGGACCCCTTTGAGG - Intergenic
1068208328 10:53886899-53886921 TTATTTTTATTGCCCATTTTGGG + Intronic
1068489298 10:57701791-57701813 GTCTTTTTAGTATCCCATTGAGG - Intergenic
1069191104 10:65491493-65491515 GTATTTTGATTACCCATTTGAGG - Intergenic
1071989552 10:91088193-91088215 CTGTTTATAGGACCCCTTTTAGG + Intergenic
1072942231 10:99776372-99776394 GTCCTTTTAGAACCCATTTTGGG + Intergenic
1073033940 10:100549899-100549921 TTATTTTTAGTACCCCATTCTGG + Exonic
1073176998 10:101562726-101562748 GTATTTTTAGTAGACCATGTTGG - Intergenic
1073786991 10:106900507-106900529 GTATTTATATAACCTCTTTTTGG - Intronic
1073898694 10:108193562-108193584 GTATTGTTGGTATACCTTTTGGG + Intergenic
1074310907 10:112322519-112322541 GGATTTTGAGTTACCCTTTTTGG + Intergenic
1078956128 11:16197140-16197162 GGCTTTTTAGTGCCCCATTTTGG + Intronic
1078971151 11:16413187-16413209 GTGTTTTTTGTCCCCCTTTTGGG - Intronic
1079220167 11:18553534-18553556 GTTTTTTTAATACCTCTTTTTGG - Intronic
1080547919 11:33339738-33339760 TTATTTTTAGTATCGCATTTTGG - Intronic
1082152309 11:48756056-48756078 GGATATTTGGGACCCCTTTTAGG - Intergenic
1083536292 11:63469531-63469553 ATCTTTTTAGTATCACTTTTGGG - Intronic
1085679362 11:78557316-78557338 TGAATTTTGGTACCCCTTTTAGG - Intronic
1086073277 11:82822267-82822289 GCATTTTTACAAGCCCTTTTGGG + Intergenic
1087913893 11:103785581-103785603 GGATTTTTAAATCCCCTTTTAGG + Intergenic
1089451442 11:118600513-118600535 TTACTTTTAATACCGCTTTTAGG + Intronic
1090099620 11:123780457-123780479 TTATTTTTAGTACACCATGTTGG - Intergenic
1090132713 11:124161318-124161340 GTATTTCTAGCTTCCCTTTTAGG - Intergenic
1090702905 11:129312372-129312394 TAATTTTTAGTGCACCTTTTTGG - Intergenic
1090921221 11:131207480-131207502 CTATTTTTATTACCCCTCTGTGG + Intergenic
1094377144 12:29802129-29802151 ATATTTTTCTTACCCATTTTCGG + Intergenic
1095644928 12:44532244-44532266 GTATTTTTGCTACCTGTTTTTGG + Intronic
1096013914 12:48248827-48248849 TTATTTTTATTACCTTTTTTGGG - Intergenic
1097480355 12:60116545-60116567 GTTTTTTTATTTCTCCTTTTTGG - Intergenic
1099424370 12:82504205-82504227 TTTTTTTTAGTACTTCTTTTTGG + Intergenic
1100101750 12:91115947-91115969 GCATTATTAGTAGCCTTTTTAGG + Intergenic
1100726363 12:97413224-97413246 GTAATTTTAGGAACCCTTCTGGG + Intergenic
1100851824 12:98719888-98719910 GTATTGTTAAAAACCCTTTTGGG + Intronic
1100947609 12:99804325-99804347 TTATTTTCAATACCCCTTTGAGG + Intronic
1103280766 12:119756392-119756414 GGGTTTTAAGTACTCCTTTTGGG + Intronic
1105654073 13:22415393-22415415 GTATTTTTCCTCCCCGTTTTAGG - Intergenic
1107417565 13:40215665-40215687 CTATTTGTAGTTCCTCTTTTAGG - Intergenic
1107703273 13:43071669-43071691 GTCTTTTTAGTAACCCTATTTGG - Intronic
1107916436 13:45156889-45156911 GTTTTTTCAGGCCCCCTTTTAGG + Intronic
1114304573 14:21410520-21410542 TTACTCTTAGTACCTCTTTTTGG - Intronic
1116063702 14:39956012-39956034 GTATTTTTTGTATCACTATTAGG - Intergenic
1116275645 14:42827896-42827918 CTATTTTCAGTATCCGTTTTTGG + Intergenic
1116747978 14:48846035-48846057 GTATTTTTAAAACAACTTTTTGG + Intergenic
1117253855 14:53958618-53958640 GTATATTTTGTCCTCCTTTTGGG - Intronic
1118664714 14:68055297-68055319 CTATTTTTAGAACCAGTTTTGGG + Intronic
1119361046 14:74050186-74050208 GTATTGCTAGTACCATTTTTCGG - Exonic
1119763590 14:77173161-77173183 GAATTTTTAGTCTCCATTTTTGG + Intronic
1120059146 14:79961289-79961311 ATATCTGTAGTACCACTTTTTGG + Intergenic
1124449748 15:29776457-29776479 GTTATTTTAGTAGCCTTTTTAGG + Intronic
1127323007 15:57865836-57865858 GTATTTTTACAATCCCTTTGTGG + Intergenic
1130037378 15:80373780-80373802 GTTTTTTTTGTTTCCCTTTTAGG + Exonic
1130865093 15:87926585-87926607 GTATTCCTTGTAGCCCTTTTAGG + Intronic
1134277546 16:12790294-12790316 TCATTTTTATTATCCCTTTTAGG + Intronic
1134381154 16:13727368-13727390 GTGTTTTTATTACACATTTTAGG - Intergenic
1137761856 16:50947588-50947610 GTATTATTAGTATGACTTTTTGG - Intergenic
1139179596 16:64730884-64730906 ATATTTTAAGTATCCCATTTTGG + Intergenic
1143392160 17:6565775-6565797 GTATTTTTAGTCACCATGTTGGG - Intergenic
1143855056 17:9842380-9842402 GGATTTTCATTTCCCCTTTTGGG - Intronic
1150033189 17:61763383-61763405 GTATTTTTTATACCAGTTTTAGG - Intronic
1151696402 17:75720412-75720434 GTATTTTTAGTACATCATGTTGG - Intergenic
1153257610 18:3188011-3188033 GTATTTTTAGTAGAGATTTTAGG + Intronic
1156535591 18:37861736-37861758 GTAATTTTAATAGGCCTTTTAGG + Intergenic
1157508924 18:48253749-48253771 CTATTTCTTTTACCCCTTTTTGG - Intronic
1163165364 19:15493903-15493925 GTATTTTTAGTAGGCCATATTGG - Intronic
1165715204 19:38040370-38040392 TTTTTTTTAATGCCCCTTTTAGG + Intronic
1167446417 19:49540443-49540465 GTATTTTTAGTACACCATCTTGG - Intronic
928345018 2:30484291-30484313 ATATTTTTAGAACTCCTTTATGG - Intronic
928502635 2:31913088-31913110 GTATTTTTAGTAGACCTTGTTGG - Intronic
928969127 2:37008781-37008803 GTATTTTTAATTGCTCTTTTTGG + Exonic
930919963 2:56741409-56741431 GTTTTTTAAGTCTCCCTTTTGGG + Intergenic
930984229 2:57565466-57565488 CCATTTTTAGTACCCTTCTTAGG - Intergenic
931514336 2:63035918-63035940 GTATTTTTAATCTCTCTTTTAGG - Intronic
931761405 2:65420342-65420364 GTATTTTTAGTACCCCTTTTGGG + Intronic
934911005 2:98254432-98254454 GGATTTATAGTACGCATTTTAGG - Intronic
935924640 2:108053732-108053754 GTATTTCTATTATCCCTTGTTGG + Intergenic
936857131 2:116972077-116972099 GTGTTTATTGTACCCTTTTTTGG + Intergenic
937744576 2:125396636-125396658 GTATTTTAAGAACACCTTCTTGG - Intergenic
938166889 2:129037629-129037651 GTATTTTTAGTGACCTTTTAAGG - Intergenic
941252673 2:163185977-163185999 ATGTTTTTAGTACCCATTTTAGG - Intergenic
941375930 2:164730884-164730906 GAATTTGTACTACACCTTTTAGG - Intronic
942794410 2:179800341-179800363 TTATTTATAGTTGCCCTTTTTGG + Intronic
943354143 2:186831007-186831029 ATATTTTTAGTACTCTTTTAAGG + Intronic
943590542 2:189791109-189791131 GGATTTTTTGAACCCATTTTTGG + Intronic
945489752 2:210441272-210441294 GTGTTTTTAGGAGCCTTTTTAGG - Intronic
947696534 2:232195084-232195106 GTCTTTTAAGTACTCATTTTGGG - Intronic
1171374691 20:24684535-24684557 GTGTTTCCAGTTCCCCTTTTTGG - Intergenic
1173084531 20:39903223-39903245 ATATTTTTAAAACACCTTTTTGG + Intergenic
1175092491 20:56516200-56516222 CTATTTTTAGTGCCACCTTTTGG + Intronic
1177547008 21:22571882-22571904 TTATTTTTATTACCACTTTATGG - Intergenic
949303385 3:2610912-2610934 GAAATTTAAGTACCCATTTTAGG - Intronic
950986628 3:17377336-17377358 TTTTTTTTAGTACCCTTTTAAGG - Intronic
950995327 3:17490107-17490129 GTTTTTTTAGTATATCTTTTTGG + Intronic
951508171 3:23472424-23472446 GTATTTCTGCTACCCCTTGTCGG - Intronic
951873784 3:27397200-27397222 GTATTTTTAGTACACCATGTTGG + Intronic
956827365 3:73010724-73010746 GTATTTTTAGTACACCATGTTGG + Intronic
960384330 3:117002927-117002949 TTACTTTTAGTACTCCTTATGGG - Intronic
961101102 3:124199877-124199899 GGTTTTTTAGTACCTCTTGTGGG + Intronic
963459616 3:145592781-145592803 TTATTTTTAGTCTCACTTTTTGG + Intergenic
965939925 3:174167343-174167365 GTATGTTTAGAACCCCCTTCAGG + Intronic
966791940 3:183679949-183679971 GTAATTTTAATCCCCCTTGTAGG - Exonic
968231047 3:197004661-197004683 GTCTTTTTAGTAGCTCTTTTAGG - Intronic
969976761 4:11110743-11110765 ATATTTTCACTAACCCTTTTGGG - Intergenic
970303853 4:14710247-14710269 ATATTATTAGTTCCACTTTTAGG + Intergenic
972540406 4:40034420-40034442 GTATTTTTAGTACACCATGTTGG - Intergenic
973993301 4:56433451-56433473 GGAGTTTTAGTACCCAGTTTAGG - Intronic
974785269 4:66611052-66611074 ATAATTTCAGTAACCCTTTTAGG - Intergenic
975121209 4:70730550-70730572 GTATTTTTAGTACACCATGTTGG - Intronic
979486476 4:121276387-121276409 GTCTTGTGAGAACCCCTTTTTGG - Intergenic
979574137 4:122266585-122266607 ATATTTTTAGTACCTATTATAGG - Intronic
982302681 4:153896113-153896135 GAATTTTAACTACCCCTTGTGGG + Intergenic
982589481 4:157288060-157288082 ACATTTTTAGGACCCCTGTTTGG + Intronic
983071345 4:163271157-163271179 GTTTTTTTAGTGTCCCTTTTTGG - Intergenic
984473968 4:180214178-180214200 GTATTTCTGGTACACCTTCTTGG + Intergenic
984963013 4:185115977-185115999 GTCTTTTTAGAACCTCATTTTGG - Intergenic
986622845 5:9693320-9693342 GTATTTTTAGTTCACCATGTTGG - Intronic
987256617 5:16160812-16160834 GTATTTTTTTTTCACCTTTTTGG - Intronic
987689725 5:21251496-21251518 GTATTTCTCTTACCCGTTTTTGG - Intergenic
990959852 5:61383044-61383066 GTATTTATTGTACCACTTTCAGG - Intronic
991599483 5:68338119-68338141 GTATTCTCAGTGCCCCTTCTAGG + Intergenic
992011398 5:72531322-72531344 ATATTTTTAGTAAACCTATTTGG - Intergenic
996378395 5:122839657-122839679 GTATTTTTAGTAGAGATTTTGGG + Intergenic
999720414 5:154395133-154395155 GTTATTTTATTACCACTTTTAGG - Intronic
1000015726 5:157273756-157273778 GTATTTTTATAACTACTTTTTGG - Intronic
1000607740 5:163342563-163342585 ATGGTTTCAGTACCCCTTTTTGG + Intergenic
1002990310 6:2232331-2232353 GTGTTTGTTGTACCCCCTTTTGG - Intronic
1003097287 6:3152466-3152488 GTATTTTTAATTCCTTTTTTAGG + Exonic
1003263741 6:4548933-4548955 GCATTTTTTGCACCCCTTTTTGG - Intergenic
1003548294 6:7079536-7079558 GTATTTCTACAATCCCTTTTTGG - Intergenic
1003790473 6:9541169-9541191 GTTTTTTTAATACCTTTTTTTGG + Intergenic
1003909099 6:10727272-10727294 GTATTTGTATTCCTCCTTTTAGG + Intronic
1003912126 6:10752374-10752396 GTATTTGTATTCCTCCTTTTAGG + Intronic
1004801330 6:19152076-19152098 GTAATTTTAGCACTCCATTTAGG - Intergenic
1006524857 6:34595311-34595333 AGTTTTTTAGTACTCCTTTTTGG - Intronic
1006998399 6:38284808-38284830 CTTTTTTTATTCCCCCTTTTAGG - Intronic
1007146190 6:39635287-39635309 TTTTTTTTAGTAACCTTTTTTGG - Intronic
1009564311 6:65292577-65292599 GTATATAAAGTACCCCCTTTAGG + Intronic
1009946264 6:70345328-70345350 CCATATTTAGTACTCCTTTTAGG + Intergenic
1011287296 6:85738715-85738737 TAATTTTTAGCACTCCTTTTTGG - Intergenic
1012136978 6:95570251-95570273 GTATTTTTAGCACGTATTTTTGG + Intergenic
1012811867 6:103968879-103968901 GTATTTTTTGTATTACTTTTTGG + Intergenic
1013679851 6:112512957-112512979 GTATTTTTAGATATCCTTTTGGG + Intergenic
1013685435 6:112575801-112575823 CTATTTTTACTACTCCTTTGTGG - Intergenic
1014045031 6:116875989-116876011 CCATTTTTAGTACCACTTGTTGG - Intergenic
1015775629 6:136811261-136811283 GCATTTATAGTTACCCTTTTTGG + Intergenic
1016121770 6:140352180-140352202 GTGTTTATAGTAGCACTTTTTGG + Intergenic
1016865818 6:148765061-148765083 GTATTTCTCTTACCCATTTTGGG + Intronic
1017232993 6:152092624-152092646 GTATTTATAGTAACACTTTTTGG - Intronic
1021475296 7:21054291-21054313 CTTTTTTTAGTATCCCTTGTAGG - Intergenic
1022311935 7:29205267-29205289 TTATTTTTAGCATCCATTTTTGG + Intronic
1024099230 7:46012297-46012319 TTATTATTAGCACCTCTTTTCGG - Intergenic
1024103994 7:46062572-46062594 GTTTTTTTATAACCTCTTTTTGG + Intergenic
1024756705 7:52541696-52541718 ATATTTTTCTTACCCGTTTTTGG + Intergenic
1025763034 7:64412735-64412757 GTATGTTTAGAACCAATTTTTGG + Intergenic
1026809561 7:73451511-73451533 GTCTGTTTAGTACCCCACTTCGG - Intronic
1027680862 7:81219756-81219778 GTATTTTTAAAACACCTTATAGG - Intergenic
1027897063 7:84058446-84058468 GTACATTTAGTTCCCCTTGTTGG - Intronic
1028336120 7:89658054-89658076 CTATTTTCAGTTCCCCTTTGAGG + Intergenic
1028673708 7:93434294-93434316 GTATTTTTCCTTCCCTTTTTAGG - Exonic
1028748243 7:94352408-94352430 GTAGTTTTAGTAGCTGTTTTTGG - Intergenic
1029790142 7:102834339-102834361 GTATCTTTAGTAACCCATTAGGG - Intronic
1030790330 7:113718883-113718905 TTATTTTTAGTAACTCTTTTTGG - Intergenic
1032644140 7:133802669-133802691 GTATTTTTAGTAGCCATGTTGGG - Intronic
1035226524 7:157436496-157436518 ATACTTTTATTACCACTTTTAGG + Intergenic
1038036103 8:23688284-23688306 GTATTTTTAGTTCCCCATGCTGG + Intergenic
1038939497 8:32287968-32287990 GTATTTTCAGTACACATTTTTGG + Intronic
1039969921 8:42313006-42313028 TTATTTTTAGTCCCCCAATTTGG - Intronic
1040062975 8:43120384-43120406 GTATTTTTAGTAGAGGTTTTAGG + Intronic
1040112866 8:43578845-43578867 GGATATTTAGGAGCCCTTTTAGG + Intergenic
1043078987 8:75740729-75740751 GTATTTTCTATATCCCTTTTGGG + Intergenic
1044001307 8:86884391-86884413 GTTTATTTAGTCACCCTTTTTGG + Intronic
1046948182 8:119994302-119994324 ATTTTTTTTGTACACCTTTTTGG - Intronic
1047293726 8:123552699-123552721 GTCTTTTTAGGTCCCGTTTTTGG - Intergenic
1049055204 8:140230924-140230946 GGGCTTTTAGGACCCCTTTTAGG + Intronic
1050756942 9:9016262-9016284 GTATTTTTAGTGCAACTATTTGG - Intronic
1052055167 9:23898031-23898053 GGATTTCTAATGCCCCTTTTGGG + Intergenic
1052890330 9:33693549-33693571 GTTTTTTTAGAGCCTCTTTTAGG + Intergenic
1053042199 9:34884413-34884435 GTATTTTTATAACAGCTTTTTGG + Intergenic
1058659344 9:107255535-107255557 GTATTTTTAGTAGACCATGTTGG - Intergenic
1058913393 9:109541908-109541930 ATATTTTTAGTACACCATGTTGG + Intergenic
1061146232 9:128800543-128800565 GTATTTTTAGTAGAGATTTTTGG + Intronic
1061154540 9:128849619-128849641 GTATTTTTAGTACACCATCTTGG - Intronic
1186092520 X:6065077-6065099 GTGTTTATTGTTCCCCTTTTTGG - Intronic
1189350225 X:40270334-40270356 GTATTTTTAGTACACCATGTTGG - Intergenic
1190973955 X:55381105-55381127 CCATGTTTAGTACCCCTTTGAGG - Intergenic
1194197366 X:90911739-90911761 GTATTTTTTCTACTACTTTTGGG - Intergenic
1194590325 X:95792432-95792454 GTATTTTTAGTAGACCATGTTGG - Intergenic
1196288236 X:113907881-113907903 GTATTTTTTGTACCATTTGTAGG - Intergenic
1198795181 X:140386951-140386973 GTATTTTTGAGACCCCTTTTTGG - Intergenic
1200544354 Y:4501057-4501079 GTATTTTTTCTACTACTTTTGGG + Intergenic
1201910497 Y:19128786-19128808 GTAGTTTAAGTTCCCTTTTTAGG - Intergenic
1202085331 Y:21130732-21130754 CTATTTTAAATACCACTTTTTGG + Intergenic