ID: 931761406

View in Genome Browser
Species Human (GRCh38)
Location 2:65420343-65420365
Sequence TATTTTTAGTACCCCTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761398_931761406 17 Left 931761398 2:65420303-65420325 CCCACCTCCGTGTTGGAGTTATT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761395_931761406 26 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761401_931761406 10 Left 931761401 2:65420310-65420332 CCGTGTTGGAGTTATTGACAGCA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761396_931761406 25 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761399_931761406 16 Left 931761399 2:65420304-65420326 CCACCTCCGTGTTGGAGTTATTG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256
931761400_931761406 13 Left 931761400 2:65420307-65420329 CCTCCGTGTTGGAGTTATTGACA 0: 1
1: 0
2: 0
3: 2
4: 90
Right 931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761406 Original CRISPR TATTTTTAGTACCCCTTTTG GGG Intronic
904895988 1:33818964-33818986 TCTTTTGAGTGCCCCTTTAGAGG - Intronic
905850897 1:41274017-41274039 TATTTTTTGTAACTTTTTTGGGG + Intergenic
906006938 1:42481637-42481659 TGTTTGTAGTTCCCCTTTTAAGG + Intronic
909239570 1:73195237-73195259 TATTTTTAGTATTACTTATGAGG + Intergenic
910955014 1:92693519-92693541 TATTTTTAAAACCACTTTTCTGG - Intronic
917174255 1:172214559-172214581 TATGTTTAGTACAGCTTTAGTGG - Intronic
917190420 1:172412425-172412447 TATTTTTACTTTCCCTTTTTTGG + Exonic
917473874 1:175351483-175351505 GATTTTTAATACCCCTTGTAGGG - Intronic
918110483 1:181451305-181451327 TATTTTTAACATCCCTTCTGTGG + Intronic
921753940 1:218830799-218830821 TATTTTTGGCACCCTTATTGAGG - Intergenic
922304646 1:224333686-224333708 TATTGCTAGTATCCCCTTTGTGG + Intergenic
923336964 1:232979112-232979134 TTTTTATAGTACCCCTGTTATGG - Exonic
924044479 1:240012958-240012980 TATTTTTTGTACAGCTTTTTCGG - Intergenic
924220418 1:241868967-241868989 TAGTTCTAGTATCTCTTTTGTGG + Intronic
924618294 1:245634212-245634234 TAGTTCTAGTACCTTTTTTGTGG + Intronic
1063962160 10:11315583-11315605 TGTATTTAGTACATCTTTTGGGG + Intronic
1065389550 10:25168613-25168635 GGTTTTAAGTACTCCTTTTGAGG - Intergenic
1066003723 10:31128319-31128341 TATGTTTAGTGCCTCTCTTGTGG + Intergenic
1066226522 10:33388858-33388880 AATTTTTACTACGGCTTTTGGGG + Intergenic
1068223810 10:54080127-54080149 TTTGTTTAAAACCCCTTTTGTGG + Intronic
1068282234 10:54888745-54888767 TTTTTTCAGTACACATTTTGGGG + Intronic
1068719142 10:60222920-60222942 TATTTTCTATACCTCTTTTGGGG + Intronic
1072053439 10:91729322-91729344 GGTTTTAAGTACCCCATTTGAGG - Intergenic
1072500873 10:96016519-96016541 TATTTTTAGTACTCTTTTACAGG - Intronic
1072765114 10:98088829-98088851 TATTTTTAGGTCCCATTGTGAGG - Intergenic
1073033941 10:100549900-100549922 TATTTTTAGTACCCCATTCTGGG + Exonic
1073898695 10:108193563-108193585 TATTGTTGGTATACCTTTTGGGG + Intergenic
1074032813 10:109705455-109705477 TATTTTTTGGACTCCTTTTCAGG - Intergenic
1075503739 10:123002817-123002839 TAGTATTACTACCCCTTTTCAGG + Intronic
1075611956 10:123861597-123861619 GATTTCTTGTTCCCCTTTTGAGG - Intronic
1076930965 10:133531536-133531558 TATTCTAAATACCCATTTTGGGG - Intronic
1077927177 11:6693447-6693469 TAATTTTAGTACCACATTTAAGG - Intergenic
1078388160 11:10911278-10911300 TATTTTTATAACTCCTTTTGAGG + Intergenic
1079419479 11:20272622-20272644 TTTTATCTGTACCCCTTTTGGGG + Intergenic
1079527963 11:21413561-21413583 TATTCTTAGTAACCCATGTGAGG - Intronic
1079894382 11:26100482-26100504 GGTTTTAAGTACTCCTTTTGAGG + Intergenic
1080265845 11:30401124-30401146 TATTTTTATAACACTTTTTGGGG - Intronic
1080540766 11:33262571-33262593 TATTTTTAGGACAGCATTTGTGG + Intronic
1081067391 11:38562503-38562525 TATTTTTAGTGCCCTAATTGAGG + Intergenic
1081378983 11:42391988-42392010 TATTTTTACTCCCCCTTTTTTGG + Intergenic
1081404027 11:42675429-42675451 TATTTATAATACCACTTTTATGG - Intergenic
1081601623 11:44499361-44499383 TATTTTTATTACTAATTTTGAGG + Intergenic
1082158657 11:48857737-48857759 TATATTTGGAACCGCTTTTGAGG + Intergenic
1082695517 11:56359152-56359174 AATTTATAGTTCCCCTGTTGTGG - Intergenic
1085064269 11:73478613-73478635 TATTTTTAGTAGCTTTATTGAGG - Intronic
1086180260 11:83942750-83942772 TATTTTTTGTACCCCATAAGGGG + Intronic
1089028979 11:115303075-115303097 TATTTGTTGCCCCCCTTTTGGGG - Intronic
1089451443 11:118600514-118600536 TACTTTTAATACCGCTTTTAGGG + Intronic
1095220705 12:39610484-39610506 CTATTTTGGTACCCCTTTTGTGG - Intronic
1096419777 12:51447254-51447276 TTTTTTTTTTACACCTTTTGTGG + Intronic
1098802841 12:74984437-74984459 TAATTATTGTACCCCTTTTCTGG + Intergenic
1099934568 12:89109983-89110005 TAATTTTATTATCACTTTTGGGG + Intergenic
1099967143 12:89459977-89459999 TATTTTTAATATTCCTTTTTAGG - Intronic
1100294679 12:93249593-93249615 CAGTTTTAGTACCACGTTTGAGG + Intergenic
1100667550 12:96771282-96771304 TATTTCTAGTCCCCAGTTTGTGG - Intronic
1100726364 12:97413225-97413247 TAATTTTAGGAACCCTTCTGGGG + Intergenic
1103280767 12:119756393-119756415 GGTTTTAAGTACTCCTTTTGGGG + Intronic
1103424362 12:120819403-120819425 TATTGTTAGTACCATTCTTGGGG + Intronic
1104651266 12:130536096-130536118 TATTTTTATTCCCCATTTTATGG + Intronic
1105398996 13:20071467-20071489 GGTTTTAAGTACTCCTTTTGAGG + Intronic
1105421680 13:20257988-20258010 TATTTTTAGTTGCCCTCTTTAGG + Intergenic
1106299738 13:28452904-28452926 TATTTTTAATGTCCCTCTTGAGG + Intronic
1107012490 13:35682285-35682307 TATTATTAGTAACTCTATTGAGG + Intergenic
1107208160 13:37820659-37820681 TATTTTTAGTTCCATTTATGTGG - Intronic
1107304027 13:38998985-38999007 TATTTTTATCACCCTTTGTGGGG + Intergenic
1109231188 13:59759376-59759398 TATTCTCAGAACCCCTTTTCTGG + Intronic
1109986091 13:69987379-69987401 AATTTTCAGTATCCATTTTGAGG - Intronic
1110442038 13:75537112-75537134 TAGTTTTAGTACTCCTATTCTGG + Intronic
1112064236 13:95775083-95775105 TATTTCTAGTATCCCCTCTGGGG + Intronic
1115693444 14:35871178-35871200 TATTTCTAGTGACCCTTTAGCGG + Exonic
1116059862 14:39909151-39909173 TATTTTTAGGAAGTCTTTTGGGG - Intergenic
1116640116 14:47451008-47451030 CCATTTTAGTATCCCTTTTGTGG - Intronic
1116935802 14:50738802-50738824 TATGCTTAACACCCCTTTTGAGG - Intronic
1117253854 14:53958617-53958639 TATATTTTGTCCTCCTTTTGGGG - Intronic
1117579429 14:57137237-57137259 CTTTTTTACTCCCCCTTTTGAGG + Intergenic
1118187267 14:63549037-63549059 TATTTTTAATACTCCTTATCTGG + Intergenic
1118664715 14:68055298-68055320 TATTTTTAGAACCAGTTTTGGGG + Intronic
1119209512 14:72820322-72820344 TATTCTTATTTCCTCTTTTGTGG - Intronic
1121646351 14:95519823-95519845 TAATTTTAGTGCCCTTCTTGTGG - Intergenic
1123160100 14:106269849-106269871 TATTTGTAATACCCTTATTGAGG + Intergenic
1124234463 15:27976141-27976163 TATTTGTAGGAGCTCTTTTGTGG + Intronic
1124351479 15:28958892-28958914 TGTTTTTAGTACTGCTTTGGTGG + Intronic
1124884414 15:33671701-33671723 TATTTTCAGTTCTCCTTTGGCGG - Intronic
1125157010 15:36599059-36599081 TATTTTTATGATCTCTTTTGAGG + Intronic
1129285752 15:74523207-74523229 TAAGCTTAGTACTCCTTTTGTGG + Intergenic
1130739973 15:86588720-86588742 TGTTTTTAGTCTCCCTCTTGGGG + Intronic
1133620998 16:7526242-7526264 AATTTTTGGTACCAGTTTTGTGG - Intronic
1139520867 16:67482012-67482034 GGTTTTAAGTACTCCTTTTGCGG - Intergenic
1139870156 16:70101482-70101504 TATTTTTAAAACATCTTTTGGGG - Intergenic
1141143163 16:81510471-81510493 TATTGTTAGTAGCCCTGTTTAGG + Intronic
1142775952 17:2139233-2139255 TATTTTACCTACCCCATTTGGGG - Intronic
1143855055 17:9842379-9842401 GATTTTCATTTCCCCTTTTGGGG - Intronic
1144549454 17:16227084-16227106 TATTTTTAATACTGCTTTTTTGG + Intronic
1144636046 17:16909760-16909782 GGTTTTAAGTACTCCTTTTGAGG - Intergenic
1145404740 17:22577856-22577878 TATTTCCAGTACATCTTTTGGGG + Intergenic
1149563107 17:57623461-57623483 CATTTTGAGTCCCCATTTTGGGG - Intronic
1149706164 17:58697038-58697060 TTTTTTTTGTTCCCCTTTTATGG + Intronic
1149837422 17:59925809-59925831 TCTTTTTTTTACCCTTTTTGTGG + Intronic
1149938270 17:60831714-60831736 TATTTTGAGTGCCTCTTTGGCGG + Intronic
1156689223 18:39685640-39685662 GGTTTTAAGTACTCCTTTTGAGG - Intergenic
1157508923 18:48253748-48253770 TATTTCTTTTACCCCTTTTTGGG - Intronic
1160041295 18:75347947-75347969 TGTTTTTAATAGCCCTTTGGGGG - Intergenic
1161893854 19:7065090-7065112 TATATTTAGTACCTCGATTGTGG - Intergenic
1164842195 19:31400892-31400914 TGTTTTTAGTATCTCTTTGGGGG + Intergenic
1165183858 19:33999754-33999776 TTTTTTTTTTACCCCTTTTTAGG - Intergenic
1166027296 19:40098967-40098989 TAATTTTATTAACCCTTTTTTGG - Intergenic
1167500100 19:49841321-49841343 CATTCTTAACACCCCTTTTGAGG - Intergenic
926367229 2:12144483-12144505 TATTTTTATTACCCTTTTAAAGG - Intergenic
927344141 2:22017337-22017359 TTTATTTAGTACACCTTTTTTGG - Intergenic
927388434 2:22563929-22563951 TATTTTTAGTACCTCTTCAGAGG + Intergenic
928229587 2:29485863-29485885 TTTTTTTAGGATCCTTTTTGTGG + Intronic
928345017 2:30484290-30484312 TATTTTTAGAACTCCTTTATGGG - Intronic
929833080 2:45365649-45365671 TTATTTTACTACCCTTTTTGTGG + Intergenic
930947134 2:57088715-57088737 AATTTTTAGTACCTTTTTTGTGG + Intergenic
931761406 2:65420343-65420365 TATTTTTAGTACCCCTTTTGGGG + Intronic
932270964 2:70409317-70409339 TATTTTTAGCACCTTTGTTGAGG - Intergenic
933899696 2:86840569-86840591 GGTTTTAAGTACCCCTTTTGAGG - Intronic
934096874 2:88614927-88614949 CATTGTTAGTAGCCTTTTTGAGG - Intronic
934915587 2:98298819-98298841 GGTTTTAAGTACCCCTTTTGAGG + Intronic
935323202 2:101908240-101908262 GGTTTTAAGTACTCCTTTTGAGG - Intergenic
935780865 2:106508656-106508678 GGTTTTAAGTACCCCTTTTGAGG + Intergenic
936370692 2:111899376-111899398 CATTATTAGTATCCCTTTTTAGG + Intronic
936411259 2:112260277-112260299 GGTTTTAAGTACTCCTTTTGAGG + Intergenic
937429117 2:121823878-121823900 TATTTTCATTACCACCTTTGAGG + Intergenic
938903545 2:135818230-135818252 TATTATTATTACCCCTTCTGAGG + Intronic
939442563 2:142268578-142268600 TATTTTAAGTACTCATTTTCTGG + Intergenic
940356801 2:152752615-152752637 GGTTTTAAGTACTCCTTTTGAGG + Intronic
940719006 2:157261046-157261068 AATTTTTAGGATCCTTTTTGAGG - Intronic
941085980 2:161119107-161119129 AATATTTAGCACCCATTTTGTGG + Intergenic
941244923 2:163084852-163084874 CAATTTTAATTCCCCTTTTGGGG - Intergenic
942573163 2:177334164-177334186 TATTTTTGTTTCCCTTTTTGTGG + Intronic
942730694 2:179057894-179057916 GGTTTTAAGTACTCCTTTTGAGG + Intergenic
942796515 2:179826752-179826774 TATTTTTAGTATATGTTTTGTGG - Intronic
943281863 2:185945114-185945136 TATTTTTAGTACCTTGATTGTGG + Intergenic
944165394 2:196714280-196714302 GGTTTTAAGTACTCCTTTTGAGG + Intronic
944492332 2:200270249-200270271 TATTTTAAGTCTCCATTTTGAGG + Intergenic
944900659 2:204212162-204212184 TATTTTTATTCCCTGTTTTGGGG + Intergenic
944992093 2:205249471-205249493 TATTTTTGGTACCCTTTTCTTGG + Intronic
947850036 2:233279340-233279362 TAATTCTAGTAACCTTTTTGCGG + Intronic
949061361 2:241959837-241959859 TATTTTTAGTTGCCATCTTGAGG + Intergenic
1171307169 20:24116642-24116664 GGTTTTAAGTACTCCTTTTGAGG + Intergenic
1179680551 21:43018111-43018133 TATTTTTATTCTCCCTTTCGAGG + Exonic
1181518159 22:23428575-23428597 TATTTTTAATCCCTATTTTGGGG + Intergenic
1182055431 22:27349909-27349931 TCTTTTAAGTTGCCCTTTTGGGG + Intergenic
949841257 3:8322729-8322751 TATGTTATGTACCCCTTTTTTGG + Intergenic
950955856 3:17052950-17052972 TATTATTAGTAAACTTTTTGGGG + Intronic
951130159 3:19033028-19033050 TCCTTTTAGTACTGCTTTTGCGG - Intergenic
951376919 3:21929565-21929587 TATTTCTAGTAGCATTTTTGTGG - Intronic
952696853 3:36275275-36275297 TATTTTTAGTTTTCCTTTTTTGG - Intergenic
954167656 3:48773296-48773318 TAATTCTAGTAGCCTTTTTGTGG + Intronic
957154021 3:76523683-76523705 TATTTTTATTATCTCTTTTCTGG + Intronic
958075435 3:88670508-88670530 TATTATTATTACCCCTTTACAGG - Intergenic
958968163 3:100581858-100581880 TAGTTTTAGTACCACATTTAAGG + Intergenic
959734639 3:109644319-109644341 TATTTTTAATACTCTTTCTGTGG + Intergenic
963472238 3:145754708-145754730 AACTTTGAGTCCCCCTTTTGAGG - Intergenic
963919537 3:150892454-150892476 TATATTTAGTTCCTCTTTGGGGG + Intronic
965316661 3:167199847-167199869 TATTTTAAGCACTCCGTTTGTGG - Intergenic
965910710 3:173772138-173772160 CATTTTTACTTTCCCTTTTGTGG + Intronic
966048024 3:175576949-175576971 TAATTTAAGCACCCCTTCTGAGG - Intronic
966405454 3:179592808-179592830 TATTTGGACTAACCCTTTTGAGG - Intronic
968231046 3:197004660-197004682 TCTTTTTAGTAGCTCTTTTAGGG - Intronic
968376895 4:51231-51253 GGTTTTTAGTACTCCTTTTGAGG - Intergenic
968402198 4:307440-307462 GGTTTTAAGTACTCCTTTTGAGG + Intergenic
968410192 4:383853-383875 GGTTTTAAGTACTCCTTTTGAGG - Intronic
968421394 4:488073-488095 GGTTTTAAGTACTCCTTTTGAGG - Intronic
970759500 4:19467327-19467349 GATTTTTAGTAGCTCTATTGAGG - Intergenic
970847571 4:20559912-20559934 TATTTCTAGTAAAGCTTTTGAGG - Intronic
971394221 4:26213872-26213894 TATTTTCAGAACACATTTTGGGG - Intronic
971998846 4:34002525-34002547 TATTTACAGTACATCTTTTGGGG - Intergenic
973088946 4:46107164-46107186 CATTTTTTGTACCCATTATGTGG + Intronic
973569851 4:52226910-52226932 TATTTTTATTACTAGTTTTGGGG - Intergenic
974785268 4:66611051-66611073 TAATTTCAGTAACCCTTTTAGGG - Intergenic
976824168 4:89240896-89240918 TATATTGATTAGCCCTTTTGAGG + Exonic
976932295 4:90582739-90582761 TATTTAAAGTAACCCTTTTCAGG + Intronic
977742006 4:100496565-100496587 TATTTCTATTACCACTTTTGTGG - Intronic
979192226 4:117875970-117875992 TTTTTTTAGTATCCATTTTTTGG - Intergenic
980845761 4:138322648-138322670 TATTATTATTAACCATTTTGTGG + Intergenic
981426484 4:144609335-144609357 AAATTTTAGTATCCCTTTTCTGG + Intergenic
981892649 4:149756505-149756527 ATTTTTTAGTAGCACTTTTGAGG - Intergenic
982396073 4:154917375-154917397 TATTTCTAGTTCCCCTGTTGAGG + Intergenic
982550561 4:156793250-156793272 TATTTTTAATATCAATTTTGGGG + Intronic
982934422 4:161453574-161453596 TATTATTATTACACATTTTGTGG - Intronic
983867296 4:172783331-172783353 TATTTTTAAAAAGCCTTTTGGGG - Intronic
984062445 4:175007043-175007065 TATTTTTTGTTCCACTTTTAAGG + Intergenic
985339446 4:188933792-188933814 TAGTTTTAGTACCACATTTAAGG - Intergenic
985428893 4:189858554-189858576 GGTTTTAAGTACCCCTTTTGAGG - Intergenic
985714962 5:1451287-1451309 TATTTGTAGTATCCATTGTGTGG + Intergenic
985848202 5:2369823-2369845 TACTTTTAATACCACTTTGGGGG - Intergenic
987327499 5:16825661-16825683 TATGTATAATACCCATTTTGAGG - Intronic
988223020 5:28374240-28374262 TAGTTTTAGTTCTCTTTTTGGGG + Intergenic
988248119 5:28715625-28715647 TATTTTTAGTAAGCCTCTGGAGG + Intergenic
988828407 5:34964073-34964095 AATTTTGATTACCCCTTGTGTGG + Intergenic
990653898 5:57933530-57933552 TATTTTTAATTCTTCTTTTGTGG - Intergenic
991189972 5:63859157-63859179 TATTTTTAGAAGCCATTTTCAGG - Intergenic
992624918 5:78628197-78628219 TAATTTCATTAGCCCTTTTGAGG - Intronic
993102160 5:83553673-83553695 TATGTTAAGTCCCCCATTTGGGG + Intronic
993652750 5:90542049-90542071 TATTTTTAATACAATTTTTGAGG + Intronic
994738955 5:103594549-103594571 TATTTTTATTAACCCTCTTTCGG + Intergenic
996131718 5:119789519-119789541 TTTTTTTAGTGCCCCTTTCATGG + Intergenic
996378396 5:122839658-122839680 TATTTTTAGTAGAGATTTTGGGG + Intergenic
997229774 5:132233993-132234015 TGTTTTTACTATCCCTTCTGGGG - Intronic
997746831 5:136306648-136306670 TATTATTTTTACCTCTTTTGTGG - Intronic
998180302 5:139933308-139933330 TATTTAAAGTGTCCCTTTTGAGG - Intronic
998629094 5:143878520-143878542 GATTTTAAGTACTCTTTTTGAGG - Intergenic
998920232 5:147059962-147059984 TGTTTTTACAACCTCTTTTGGGG + Intronic
1000607741 5:163342564-163342586 TGGTTTCAGTACCCCTTTTTGGG + Intergenic
1001781544 5:174373204-174373226 TATATTTAGACCCCATTTTGTGG - Intergenic
1003863208 6:10340689-10340711 TATTTTTATTTCCCGTTTGGTGG - Intergenic
1006529234 6:34636090-34636112 TATTTTTAAAACCTTTTTTGTGG - Intronic
1007015559 6:38463258-38463280 TAGTTTTAGTAGCTTTTTTGTGG + Intronic
1007455156 6:41971447-41971469 TATTTATAATCCCCATTTTGTGG + Intronic
1009875828 6:69504002-69504024 TATTTTTTGTACCTATTATGAGG - Intergenic
1010528422 6:76933952-76933974 TATTTTCAATACACCTTTTATGG + Intergenic
1011287295 6:85738714-85738736 AATTTTTAGCACTCCTTTTTGGG - Intergenic
1011887702 6:92118201-92118223 TCTGTTTACTACCCCTTGTGAGG - Intergenic
1012296441 6:97530612-97530634 TATTATTAGTAACCATTTTCAGG - Intergenic
1014045030 6:116875988-116876010 CATTTTTAGTACCACTTGTTGGG - Intergenic
1014617561 6:123622204-123622226 TATATTTAGTATCCATTTAGTGG - Intronic
1015599812 6:134901390-134901412 TAATTTCAGTAACCCTTTTCTGG - Intergenic
1016402681 6:143697807-143697829 TATTTTTAGGGACCTTTTTGTGG + Intronic
1017612095 6:156198466-156198488 TATCTCTTGTACCCCTTCTGAGG + Intergenic
1019477997 7:1253157-1253179 TTTTTTTAGAACTACTTTTGTGG - Intergenic
1019600130 7:1877861-1877883 TATTTTTAATCCCTATTTTGGGG - Intronic
1020983645 7:15104723-15104745 TAATTTTAGTACTCCCTCTGGGG + Intergenic
1022311936 7:29205268-29205290 TATTTTTAGCATCCATTTTTGGG + Intronic
1024809075 7:53185894-53185916 TATTTTTAGATCTCCTTTTTTGG - Intergenic
1028837321 7:95389318-95389340 TATTATAAGTACCCCTTTTTTGG + Intronic
1030380189 7:108802466-108802488 TGTTTTAAGTACTCCTTTTGAGG - Intergenic
1030943118 7:115680411-115680433 TATTTTTATTACATATTTTGTGG - Intergenic
1031340623 7:120595707-120595729 TATTTTTAATCCCATTTTTGAGG + Intronic
1032912006 7:136443250-136443272 TATTTTTAGTTCTGCTTATGTGG - Intergenic
1035226525 7:157436497-157436519 TACTTTTATTACCACTTTTAGGG + Intergenic
1035949950 8:4009292-4009314 GAATTTTTGTGCCCCTTTTGTGG + Intronic
1036159284 8:6371439-6371461 GCTTTTAAGTACTCCTTTTGAGG + Intergenic
1036162091 8:6398849-6398871 TAGTTTTAGTACTGCATTTGAGG - Intergenic
1038908189 8:31931314-31931336 TTTTTTTAGTTCCTCTTTTTTGG - Intronic
1039269958 8:35869515-35869537 GCTTTTAAGTACTCCTTTTGAGG - Intergenic
1040926025 8:52684129-52684151 TATTTTTATTACTGTTTTTGGGG - Intronic
1041914185 8:63122885-63122907 TATTTTTAGTTCCTATTTTTAGG + Intergenic
1042356055 8:67829029-67829051 TATTTTTTAAACCCTTTTTGGGG + Intergenic
1042385387 8:68167868-68167890 TATTTTAAGAACCACTTTAGGGG - Intronic
1046093629 8:109532825-109532847 TATTTTAAATAGCACTTTTGGGG - Intergenic
1046948181 8:119994301-119994323 TTTTTTTTGTACACCTTTTTGGG - Intronic
1047056246 8:121167996-121168018 TTTTTTTTTTCCCCCTTTTGTGG + Intergenic
1047629088 8:126686536-126686558 TATTATTAGTGCTCCTTTGGGGG + Intergenic
1047873905 8:129114280-129114302 TTTTTATAGTATCCCATTTGTGG + Intergenic
1048915390 8:139177982-139178004 GGTTTTAAGTACTCCTTTTGAGG - Intergenic
1050846038 9:10220137-10220159 TTTTTTTAGTATCACTTTTAAGG + Intronic
1052304819 9:26995931-26995953 TATTTTTAATACCAATATTGAGG - Intronic
1052484147 9:29074380-29074402 AATTTTTATTAGCCCGTTTGTGG - Intergenic
1054716889 9:68565483-68565505 TATTATTATTATTCCTTTTGGGG - Intergenic
1056502736 9:87225750-87225772 TCTTTTGAGTATCCCCTTTGAGG - Intergenic
1056971510 9:91208689-91208711 TGTTTATAGTACCAATTTTGGGG - Intergenic
1062020535 9:134317377-134317399 TATGTTGAGCACCCATTTTGGGG + Intronic
1203572339 Un_KI270744v1:143015-143037 GGTTTTTAGTACTCCTTTTGAGG + Intergenic
1185503355 X:615427-615449 TGTTTCTAGAACCCCTGTTGGGG - Intergenic
1186556441 X:10564990-10565012 TTTTTTTTTTACCCCTTTTTTGG - Intronic
1189902144 X:45717543-45717565 TATTTTTAATACCTTTATTGAGG - Intergenic
1191008470 X:55737063-55737085 TATATGCAGTACCCCATTTGTGG + Intronic
1191201914 X:57792201-57792223 GATTTTAAGTATTCCTTTTGAGG - Intergenic
1192822774 X:74661857-74661879 TGTTTTTACTACCTCTTTAGTGG + Intergenic
1193917000 X:87378299-87378321 TGTTTTTACTACCTCTTTGGTGG - Intergenic
1194080233 X:89453706-89453728 TTTTTTTAGTACTGCTTATGTGG - Intergenic
1194408263 X:93525142-93525164 TATTTTTTTTTCCCATTTTGTGG + Intergenic
1194530421 X:95041298-95041320 TATGTCTATCACCCCTTTTGAGG - Intergenic
1195008684 X:100713612-100713634 TTTTTTTTTTCCCCCTTTTGAGG - Intronic
1195212480 X:102662766-102662788 TACTTATAGTACCCCTTTCCAGG - Intergenic
1195780610 X:108459199-108459221 TATTTTTAGTAGCTCTTTCATGG + Intronic
1197146402 X:123177287-123177309 TATTTTTAACACTCCTTTAGAGG - Intergenic
1197547704 X:127846619-127846641 TATTCTTAGAACCCTTGTTGAGG + Intergenic
1198011303 X:132557852-132557874 TATTTTCAATGTCCCTTTTGGGG - Intergenic
1198795180 X:140386950-140386972 TATTTTTGAGACCCCTTTTTGGG - Intergenic
1199429790 X:147746031-147746053 TGTTTTTGAAACCCCTTTTGTGG + Intergenic
1200432912 Y:3109769-3109791 TTTTTTTAGTACTGCTTATGTGG - Intergenic