ID: 931761407

View in Genome Browser
Species Human (GRCh38)
Location 2:65420344-65420366
Sequence ATTTTTAGTACCCCTTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761398_931761407 18 Left 931761398 2:65420303-65420325 CCCACCTCCGTGTTGGAGTTATT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761401_931761407 11 Left 931761401 2:65420310-65420332 CCGTGTTGGAGTTATTGACAGCA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761400_931761407 14 Left 931761400 2:65420307-65420329 CCTCCGTGTTGGAGTTATTGACA 0: 1
1: 0
2: 0
3: 2
4: 90
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761395_931761407 27 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761396_931761407 26 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183
931761399_931761407 17 Left 931761399 2:65420304-65420326 CCACCTCCGTGTTGGAGTTATTG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG 0: 1
1: 1
2: 1
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761407 Original CRISPR ATTTTTAGTACCCCTTTTGG GGG Intronic
905850898 1:41274018-41274040 ATTTTTTGTAACTTTTTTGGGGG + Intergenic
907179185 1:52554014-52554036 ATTTCTAAAACCTCTTTTGGGGG - Intergenic
909139995 1:71851381-71851403 ATTTTTAGCACACCTCTTGCTGG - Intronic
909939055 1:81589427-81589449 ATTTTTAATACCCATTAGGGAGG - Intronic
910019612 1:82570877-82570899 AATTTTAGTACCTGTTTGGGAGG + Intergenic
910780529 1:90927513-90927535 ATTTTTCCTAACCATTTTGGTGG - Intronic
912014864 1:105020226-105020248 ATTTTCAGTATCCTTTCTGGGGG + Intergenic
913977914 1:143479236-143479258 ATTTTTAATACCTCTTTTTATGG - Intergenic
914072317 1:144304865-144304887 ATTTTTAATACCTCTTTTTATGG - Intergenic
914106838 1:144661491-144661513 ATTTTTAATACCTCTTTTTATGG + Intergenic
915038994 1:152952027-152952049 AGTATAAGTACCCCATTTGGTGG + Intergenic
917762288 1:178175245-178175267 ATTTTTATTAACTTTTTTGGGGG + Intronic
918599044 1:186331157-186331179 ATTTATAGTGCCCCATTTGCTGG - Intronic
919842366 1:201618743-201618765 AGTTTTAGTACCCCTTTCACAGG - Intergenic
920808332 1:209256338-209256360 CCTTTTAGTTCCCCTTCTGGAGG + Intergenic
921434705 1:215104959-215104981 ATTTGTAGAACCCTTTTTAGAGG + Intronic
922249227 1:223832462-223832484 TTTTGTTGTACCCCTTATGGAGG + Intronic
922568279 1:226616280-226616302 AGTTTTGGTGCCCCATTTGGGGG - Intergenic
924082563 1:240414311-240414333 ATTCTTAGTACCCATTTTGCAGG + Intronic
924133508 1:240937962-240937984 AATTTTACTAACCCTTTTGTTGG - Intronic
1064064606 10:12170641-12170663 ATATTTAGTACCCAGTTTGCTGG + Intronic
1064520480 10:16195771-16195793 ATTTTTAGCAAACCTTTAGGCGG - Intergenic
1064573035 10:16715185-16715207 TTGTTTAGATCCCCTTTTGGGGG + Intronic
1065025538 10:21535782-21535804 AATTTTCGTCTCCCTTTTGGTGG - Intronic
1068347920 10:55808077-55808099 ATCTTTAGTCCACCTTTTGATGG + Intergenic
1068719143 10:60222921-60222943 ATTTTCTATACCTCTTTTGGGGG + Intronic
1070141777 10:73743688-73743710 ATTATTAGTACCCCATTTAATGG - Intergenic
1072825703 10:98603910-98603932 ATTTTTCTTCCCTCTTTTGGTGG - Intronic
1073033942 10:100549901-100549923 ATTTTTAGTACCCCATTCTGGGG + Exonic
1073898696 10:108193564-108193586 ATTGTTGGTATACCTTTTGGGGG + Intergenic
1077944179 11:6877137-6877159 ATTTTCAGTTTCCCTTTTTGTGG + Exonic
1080265844 11:30401123-30401145 ATTTTTATAACACTTTTTGGGGG - Intronic
1084990007 11:72913881-72913903 ATTTGTAGTTCTCCTTTTAGAGG - Intronic
1086034170 11:82396526-82396548 ATTTTTTGGATCCATTTTGGAGG + Intergenic
1089028978 11:115303074-115303096 ATTTGTTGCCCCCCTTTTGGGGG - Intronic
1090848280 11:130548063-130548085 ATTTGAACTACCCCTTTTAGTGG - Intergenic
1091638305 12:2214905-2214927 TTCTTGAGTACCTCTTTTGGCGG - Intronic
1091823602 12:3493337-3493359 ATTTTTAGAAACCCTTTCGGCGG - Intronic
1092758961 12:11791960-11791982 ATTTTGAGAACCCCGTTGGGAGG + Intronic
1092761195 12:11812839-11812861 ATTTCTATTTCCCCTTGTGGTGG - Intronic
1095245798 12:39919683-39919705 ATTGTCAGTACCCCTTGGGGTGG - Intronic
1095509193 12:42930860-42930882 ATTTTTAGTTTCTCTTTTGTAGG + Intergenic
1098423392 12:70329518-70329540 ATTGTTGGTACCCCTGTTGTTGG - Exonic
1099149421 12:79090582-79090604 ATTTTTCTTACCCCTTCTGAAGG + Intronic
1099218689 12:79885482-79885504 CCTTTTAGTGCCACTTTTGGTGG + Intronic
1100253118 12:92851594-92851616 ATTTTTATTACCAGTTTTGTAGG - Intronic
1100294680 12:93249594-93249616 AGTTTTAGTACCACGTTTGAGGG + Intergenic
1100860895 12:98805785-98805807 ATATTCAGTTTCCCTTTTGGAGG - Intronic
1101065997 12:101021261-101021283 ATTTTCAGTATCCCCTTGGGGGG - Intronic
1105221433 13:18332225-18332247 ATTTTTAATACCTCTTTTTATGG + Intergenic
1105270736 13:18873031-18873053 ATTTTAAGTAGCCCTTTAAGTGG - Intergenic
1107304028 13:38998986-38999008 ATTTTTATCACCCTTTGTGGGGG + Intergenic
1108343230 13:49518166-49518188 ATTTTTAAAACCACATTTGGGGG + Intronic
1111767495 13:92550598-92550620 TTTTTTAATACCCCTTTTTCAGG - Intronic
1115701925 14:35962020-35962042 ATTATTAGTAACCATTTTTGTGG - Intergenic
1115804265 14:37033646-37033668 TATTTTAGTACTCCTTTTGATGG + Intronic
1120413526 14:84190233-84190255 ATTTCTATGACCCTTTTTGGAGG - Intergenic
1124909855 15:33909008-33909030 ATTTTTAATACCCCCTGTAGTGG + Intronic
1125092166 15:35806505-35806527 ATCTCTAGTATCCCTTTTGTAGG + Intergenic
1125399675 15:39287568-39287590 ATTTTTAGAACCCTTTTTCTAGG - Intergenic
1126659858 15:51022199-51022221 TTTTTTAGTTCTCTTTTTGGTGG + Intergenic
1130766188 15:86873808-86873830 AATATTACTACCTCTTTTGGTGG + Intronic
1137707621 16:50546595-50546617 TTTTTTAACACCCTTTTTGGTGG - Intergenic
1142775951 17:2139232-2139254 ATTTTACCTACCCCATTTGGGGG - Intronic
1143855054 17:9842378-9842400 ATTTTCATTTCCCCTTTTGGGGG - Intronic
1144204638 17:12971417-12971439 ATTTTTAGGACTCCTTGTGCTGG + Intronic
1144499672 17:15774680-15774702 ATTATTAATCCTCCTTTTGGGGG + Intergenic
1144549351 17:16226234-16226256 ATGTTTAGTACCTCATTTGGAGG + Intronic
1144593104 17:16541395-16541417 ATCTTTATTATCCCTTTTGCCGG - Intergenic
1148726035 17:49790612-49790634 TTTTTTAGTAACCTGTTTGGCGG + Intronic
1149954340 17:61031133-61031155 TTTTTAAAGACCCCTTTTGGAGG + Intronic
1150038797 17:61835080-61835102 AATTTAAGTACACATTTTGGTGG + Intronic
1150670329 17:67190618-67190640 CTTTTCAGTGCCTCTTTTGGAGG - Intronic
1154059947 18:11050179-11050201 TTTTTTAGCATTCCTTTTGGTGG + Intronic
1154417310 18:14186922-14186944 ATTTTAAGTAGCCCTTTAAGTGG + Intergenic
1162002206 19:7752326-7752348 ATTCTTATTACCCCTTTTCTTGG + Intergenic
1166559876 19:43725558-43725580 ATTTTTAGATCACCTTTTGGTGG + Intergenic
1167246533 19:48376354-48376376 GTTTTTAGAAACCCTTCTGGAGG - Exonic
1168537964 19:57187141-57187163 ATTATTGTTCCCCCTTTTGGGGG + Intergenic
925031965 2:657476-657498 ACTTTTAGTATTGCTTTTGGAGG + Intergenic
931689538 2:64823421-64823443 ATGTTGGGTACCCCTTTAGGGGG + Intergenic
931761407 2:65420344-65420366 ATTTTTAGTACCCCTTTTGGGGG + Intronic
931839965 2:66138066-66138088 AATTTTAGGACCCATTATGGTGG - Intergenic
933039900 2:77451255-77451277 ATTTTTAAACCCCCTGTTGGAGG - Intronic
934292917 2:91714434-91714456 ATTTTTAATACCTCTTTTTATGG - Intergenic
936370693 2:111899377-111899399 ATTATTAGTATCCCTTTTTAGGG + Intronic
936747244 2:115592063-115592085 TTTTTCAGTGCCCCTTTAGGAGG - Intronic
940719005 2:157261045-157261067 ATTTTTAGGATCCTTTTTGAGGG - Intronic
941710582 2:168708021-168708043 ATTGTTAGTATACCATTTGGGGG + Intronic
942264513 2:174208362-174208384 ATTCATACTACCCCTTTTTGGGG - Intronic
943369509 2:187001122-187001144 ATTTTTATTATTTCTTTTGGAGG + Intergenic
943381886 2:187160001-187160023 ATTTTTATCACAGCTTTTGGAGG + Intergenic
944653216 2:201852883-201852905 TTTTTTAGTATCCATTTTGTTGG + Intronic
945685466 2:212964002-212964024 ATGTTCATTAGCCCTTTTGGTGG + Intergenic
1170782691 20:19439574-19439596 ATTATTAGTAATCATTTTGGTGG - Intronic
1171312425 20:24155426-24155448 ATTTTAAGGACTCCTTTTGATGG + Intergenic
1171891154 20:30717127-30717149 ATTTTAAGTAGCCCTTTAAGTGG - Intergenic
1174607964 20:51774779-51774801 CTTCTTAGTGCCCTTTTTGGAGG - Intergenic
1176729857 21:10483032-10483054 ATTTTTAATACCTCTTTTTATGG + Intergenic
1176856012 21:13972338-13972360 ATTTTAAGTAGCCCTTTAAGTGG - Intergenic
1177615456 21:23511953-23511975 ATTTTTATCATCCTTTTTGGGGG - Intergenic
1177930865 21:27281649-27281671 ATTTTTAGTTCTCCTTTTTATGG + Intergenic
1183016266 22:34990289-34990311 AATTGTAGTGCCCCTCTTGGTGG + Intergenic
949463687 3:4321743-4321765 ATTTATGGTCCCCCTTTTCGTGG - Intronic
950674789 3:14548194-14548216 CTCTTTAGGGCCCCTTTTGGTGG - Intergenic
956457179 3:69433748-69433770 ATTTTTAGTACCCCTTTAGGAGG + Intronic
956553184 3:70485182-70485204 CTTTTTGTTACCACTTTTGGAGG - Intergenic
959657682 3:108828338-108828360 ATTTCTAATACCCCTTTTTCTGG - Intronic
960843711 3:121987080-121987102 ATTTTTCGAAGCCCCTTTGGAGG - Intergenic
963394303 3:144712883-144712905 ATTTTTATTTCTCCTTTAGGAGG + Intergenic
964369499 3:155985098-155985120 ATATCTGATACCCCTTTTGGTGG - Intergenic
964566284 3:158057269-158057291 ATTTTTAGTTCCCGTTCTTGTGG - Intergenic
964821049 3:160769864-160769886 AATTTTTGTACCCATTTCGGAGG + Intronic
968951769 4:3698969-3698991 ATTTTTATTTCTGCTTTTGGTGG - Intergenic
970475376 4:16416939-16416961 ATGTTTAGAACACCTTTTGTTGG + Intergenic
972205031 4:36761367-36761389 ATTTTTAGAAACATTTTTGGGGG - Intergenic
973056458 4:45665289-45665311 ATTGTCAGTAACCTTTTTGGTGG + Intergenic
973569850 4:52226909-52226931 ATTTTTATTACTAGTTTTGGGGG - Intergenic
974264722 4:59570191-59570213 ATTTGAAGTACCACTTTTTGTGG - Intergenic
974575276 4:63711615-63711637 ATTTTAAGTAACCCTCTTTGTGG + Intergenic
975617368 4:76260019-76260041 TTTTGTAGTTCCCCTTGTGGAGG - Intronic
980434013 4:132745135-132745157 ATTTTTAGTCTCCCTTTCAGTGG + Intergenic
983296834 4:165876764-165876786 ATTCTTAGTTGGCCTTTTGGAGG + Intronic
983310184 4:166050267-166050289 ATTTTAAGTACCCCTTTTTAAGG + Intronic
985176709 4:187210301-187210323 ATTTTTAGAAAGCATTTTGGAGG + Intergenic
985848201 5:2369822-2369844 ACTTTTAATACCACTTTGGGGGG - Intergenic
987798096 5:22655611-22655633 ATTTTAAATACCCTTTTTTGTGG + Intronic
988223021 5:28374241-28374263 AGTTTTAGTTCTCTTTTTGGGGG + Intergenic
991391985 5:66154531-66154553 ATTTTTAAAACCTCTTTTAGTGG + Intronic
993655514 5:90573549-90573571 ATTTTTACTACACCTTTTCTAGG - Intronic
994215607 5:97133941-97133963 ATTTTTAAGATCCCTTTTTGTGG - Intronic
994793321 5:104260239-104260261 ATTTTTCTTACCTCTTTTAGTGG - Intergenic
994938057 5:106282178-106282200 ATATTTAGTACATATTTTGGTGG + Intergenic
996040746 5:118807677-118807699 ATTCTTAGTACCCCATTTTATGG + Intergenic
997335301 5:133104287-133104309 TTTTTTTGTTCCTCTTTTGGAGG - Exonic
998920233 5:147059963-147059985 GTTTTTACAACCTCTTTTGGGGG + Intronic
1000554299 5:162705749-162705771 ATTTTAACAAGCCCTTTTGGGGG + Intergenic
1000718752 5:164679823-164679845 ATTTTTAGAAAACCTTTAGGGGG + Intergenic
1002180503 5:177428753-177428775 AACTTCAGTACCCCTTTTTGTGG + Intronic
1006233718 6:32608715-32608737 ACCTTTTGTACCCCTTTTGGAGG + Intergenic
1006253466 6:32810614-32810636 GTTTTCAGTAGCCATTTTGGTGG + Intergenic
1007855704 6:44854186-44854208 ATTTTTATTCCCCTGTTTGGGGG - Intronic
1010343672 6:74786704-74786726 TTTTTTAATACATCTTTTGGTGG + Intergenic
1011287294 6:85738713-85738735 ATTTTTAGCACTCCTTTTTGGGG - Intergenic
1015518643 6:134110140-134110162 ATTTTTAGTAGCACTTTGGGAGG + Intergenic
1015678528 6:135778779-135778801 GTTTTTACTACCCCTTATGATGG - Intergenic
1015679926 6:135794968-135794990 ATTTTTATGACAACTTTTGGAGG - Intergenic
1015884891 6:137906982-137907004 ATTTTTATTACTCTTTTTGTTGG + Intergenic
1017612069 6:156197837-156197859 ATTTCTATTACCTATTTTGGAGG + Intergenic
1019046358 6:169150971-169150993 ATTACTAGTATCCCTTTTGATGG + Intergenic
1020107596 7:5429321-5429343 ATTTCTAGAAGCACTTTTGGAGG + Intergenic
1021743933 7:23719039-23719061 ATTTTTATTAGCCCTTTGGAAGG + Intronic
1023672314 7:42590626-42590648 ATTTGTAGTTCTCCTTATGGTGG + Intergenic
1024105536 7:46080914-46080936 ATTTTTAGTACTACTTTTTATGG + Intergenic
1024470464 7:49764472-49764494 ATTTTTTATCCCCCTTTAGGTGG - Intergenic
1026284685 7:68952968-68952990 GTTTTTAGTACTCATTTTTGCGG - Intergenic
1028021660 7:85783602-85783624 ATTTTTTGTTCCACTTTTGGTGG - Intergenic
1031616553 7:123888617-123888639 AACTTTTGTACCCCATTTGGAGG + Intergenic
1034599730 7:152238511-152238533 ATTTTTAATACCTCTTTTTATGG - Intronic
1035427287 7:158787962-158787984 ATTTTTATTTTCCCATTTGGTGG - Intronic
1035704552 8:1665596-1665618 TTTTTTACTACCCCTATTGCTGG + Intronic
1035949951 8:4009293-4009315 AATTTTTGTGCCCCTTTTGTGGG + Intronic
1037018787 8:13942419-13942441 ATTCTTAGAACCACCTTTGGGGG - Intergenic
1039092006 8:33841163-33841185 ATTTTTCTTTCCCCTTTTGATGG + Intergenic
1039133435 8:34293775-34293797 ATTTTTAGTTCCCCTTTTTGTGG + Intergenic
1041143963 8:54852127-54852149 ATTTTTAATAGCCCTCTTGACGG - Intergenic
1042224450 8:66504601-66504623 ATTTTTAAGGCCCATTTTGGTGG + Intronic
1042674480 8:71304614-71304636 ATTTTTAGTACCAATTCAGGAGG + Intronic
1044198718 8:89409355-89409377 AGTTTCAGTCCCCATTTTGGGGG - Intergenic
1044364038 8:91322574-91322596 ATTTTTATTGTGCCTTTTGGGGG - Intronic
1045482979 8:102607796-102607818 ATTTGAATTACCACTTTTGGTGG - Intergenic
1049055206 8:140230926-140230948 GCTTTTAGGACCCCTTTTAGGGG + Intronic
1049076832 8:140403601-140403623 ATTGTTAATAACCTTTTTGGAGG + Intronic
1052484146 9:29074379-29074401 ATTTTTATTAGCCCGTTTGTGGG - Intergenic
1054357692 9:64078661-64078683 ATTTTAAGTAGCCCTTTAAGTGG + Intergenic
1055254222 9:74347423-74347445 ATTATAAGTAACACTTTTGGAGG - Intergenic
1056311886 9:85349123-85349145 ATTTTGAGTCCCCATTGTGGTGG + Intergenic
1056971509 9:91208688-91208710 GTTTATAGTACCAATTTTGGGGG - Intergenic
1058138124 9:101329882-101329904 CTTTTTATTCCCCCTCTTGGCGG + Intergenic
1058247383 9:102644671-102644693 ATTTTTAATACCGCTTTTTTTGG + Intergenic
1059011756 9:110468880-110468902 AATTTTTGTTTCCCTTTTGGGGG - Intronic
1059981406 9:119776213-119776235 AATTTTAGTAACGGTTTTGGTGG + Intergenic
1062020536 9:134317378-134317400 ATGTTGAGCACCCATTTTGGGGG + Intronic
1203560768 Un_KI270744v1:54856-54878 ATTTTAAGTAGCCCTTTAAGTGG - Intergenic
1203584425 Un_KI270746v1:51043-51065 ATTTTTAATACCTCTTTTTATGG - Intergenic
1186006414 X:5077144-5077166 TTTTTTAGCAAACCTTTTGGGGG + Intergenic
1186394223 X:9191788-9191810 GTTTTTGGTAACCATTTTGGTGG + Intergenic
1188120045 X:26293702-26293724 ATTTTTACTGCCTCTATTGGAGG - Intergenic
1188191910 X:27182103-27182125 ATTTTTAGCAAACCTTTAGGGGG - Intergenic
1189621319 X:42842390-42842412 ATTTTTAGTTTCCTTTTTTGGGG + Intergenic
1193074852 X:77345077-77345099 ATTTTTGTTATCCCTTTTAGGGG + Intergenic
1198011302 X:132557851-132557873 ATTTTCAATGTCCCTTTTGGGGG - Intergenic
1198068393 X:133122916-133122938 ATTTTTAGCAAACCTTTAGGGGG - Intergenic
1198795179 X:140386949-140386971 ATTTTTGAGACCCCTTTTTGGGG - Intergenic
1201858012 Y:18566874-18566896 ATTTTTATAACCACTTCTGGAGG - Intronic
1201875309 Y:18753507-18753529 ATTTTTATAACCACTTCTGGAGG + Intronic
1201924736 Y:19272116-19272138 CTTGTTAGTACCCCTTTAAGTGG + Intergenic