ID: 931761408

View in Genome Browser
Species Human (GRCh38)
Location 2:65420345-65420367
Sequence TTTTTAGTACCCCTTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931761401_931761408 12 Left 931761401 2:65420310-65420332 CCGTGTTGGAGTTATTGACAGCA 0: 1
1: 0
2: 1
3: 16
4: 185
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761396_931761408 27 Left 931761396 2:65420295-65420317 CCATTGTACCCACCTCCGTGTTG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761399_931761408 18 Left 931761399 2:65420304-65420326 CCACCTCCGTGTTGGAGTTATTG 0: 1
1: 0
2: 2
3: 8
4: 145
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761400_931761408 15 Left 931761400 2:65420307-65420329 CCTCCGTGTTGGAGTTATTGACA 0: 1
1: 0
2: 0
3: 2
4: 90
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761398_931761408 19 Left 931761398 2:65420303-65420325 CCCACCTCCGTGTTGGAGTTATT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151
931761395_931761408 28 Left 931761395 2:65420294-65420316 CCCATTGTACCCACCTCCGTGTT 0: 1
1: 0
2: 1
3: 5
4: 57
Right 931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931761408 Original CRISPR TTTTTAGTACCCCTTTTGGG GGG Intronic
900464058 1:2815558-2815580 TTTTTAAGACCCCTGTGGGGTGG + Intergenic
900843439 1:5076659-5076681 TTATTTGTAACCCTTGTGGGAGG + Intergenic
901778257 1:11575460-11575482 TTTTTAAACCCACTTTTGGGAGG - Intergenic
905850899 1:41274019-41274041 TTTTTTGTAACTTTTTTGGGGGG + Intergenic
911264839 1:95730979-95731001 TGTCTAGTGCTCCTTTTGGGGGG + Intergenic
912881353 1:113419343-113419365 TTTTTATTACTCAGTTTGGGAGG + Intronic
916225416 1:162485222-162485244 TTATTAGTATACCTTTTGCGTGG - Intergenic
916513422 1:165493658-165493680 TTTCTAATAGCCCTTTTGGGTGG - Intergenic
917082528 1:171271330-171271352 TTTTTTGTCTCCCCTTTGGGAGG + Intronic
917762289 1:178175246-178175268 TTTTTATTAACTTTTTTGGGGGG + Intronic
919571925 1:199259891-199259913 ATTTTCCTACCCCTTTTGTGAGG - Intergenic
920863490 1:209731574-209731596 TTATTAATACCCTTTTTAGGAGG - Intronic
923156976 1:231287902-231287924 ATTTTAGTATCCCCTTAGGGAGG + Intergenic
1063906763 10:10788283-10788305 TATTTAGTCACCCTTTTAGGGGG - Intergenic
1064684552 10:17846347-17846369 TTATTATTACCTCTTTTTGGAGG + Intronic
1065607480 10:27433637-27433659 TTTTTTTTACCCTTTTAGGGTGG - Intergenic
1066295477 10:34050532-34050554 TTGTTTCTACCCCTTTTGGGTGG - Intergenic
1071068982 10:81669769-81669791 TTTTTTGTACCCATGTTTGGTGG - Intergenic
1073898697 10:108193565-108193587 TTGTTGGTATACCTTTTGGGGGG + Intergenic
1074314408 10:112348333-112348355 TTTTTAGGACCGTTTTTGGAAGG - Intergenic
1074529422 10:114287093-114287115 TTTTTATGACCCCTATTGGAAGG + Intronic
1076915733 10:133422477-133422499 TCCTTAGGACCCATTTTGGGGGG - Exonic
1077663065 11:4086310-4086332 CTTTTAGGACCCCTGGTGGGAGG + Intronic
1078287124 11:9968161-9968183 TTATGATTACCCTTTTTGGGAGG + Intronic
1079448104 11:20574638-20574660 TTTTTTGTCTCCCCTTTGGGAGG - Intergenic
1079944783 11:26728376-26728398 TTTTTAGCTCCCTTTCTGGGTGG + Intergenic
1081476062 11:43432787-43432809 TTTTTAGTTCCCCTTTGAGCTGG + Intronic
1084342653 11:68517118-68517140 TTTTTAGAACCCCTGTTGGTTGG + Intronic
1085679361 11:78557313-78557335 ATTTTGGTACCCCTTTTAGGAGG - Intronic
1090617055 11:128524176-128524198 TTTTTAGTATCTAATTTGGGTGG - Intronic
1091638304 12:2214904-2214926 TCTTGAGTACCTCTTTTGGCGGG - Intronic
1091823601 12:3493336-3493358 TTTTTAGAAACCCTTTCGGCGGG - Intronic
1099360196 12:81691116-81691138 TTTTAATTACCCCTTGTGGTAGG - Intronic
1099584787 12:84503161-84503183 TTTTTGATATCCCTGTTGGGTGG + Intergenic
1101109783 12:101474382-101474404 TTTTTTGTAAACCTTGTGGGTGG - Intergenic
1103666618 12:122572012-122572034 TATATAGTTCCCCTTTTGGTTGG - Intronic
1103748626 12:123143415-123143437 TGTTTATTTCCCCTTTTGAGAGG - Intronic
1106516745 13:30463243-30463265 TTTTTTGTCTCCCCTTTGGGAGG + Exonic
1106596674 13:31147477-31147499 TTTTTGGTACATATTTTGGGGGG - Intronic
1110812800 13:79829149-79829171 TGTTTGGTGCCCCTTTTGTGAGG - Intergenic
1114551730 14:23536515-23536537 TATTTGTTACCTCTTTTGGGAGG - Intronic
1115804266 14:37033647-37033669 ATTTTAGTACTCCTTTTGATGGG + Intronic
1115871361 14:37807206-37807228 ATTTTAATACCCTTTTTGGGAGG + Intronic
1116103568 14:40471555-40471577 TTTTTGTTACGTCTTTTGGGAGG - Intergenic
1116200183 14:41783531-41783553 TTTTTAGTGGCCATTTTGGTTGG + Intronic
1119924056 14:78474714-78474736 TTTCTAGTAGCCCTTATGGTAGG - Intronic
1125524052 15:40364335-40364357 TATCTAGCACCCCTTCTGGGTGG + Intronic
1128871854 15:71165158-71165180 TTTTTTGTCTCCCCTTTGGGAGG + Intronic
1129516725 15:76161680-76161702 TGGTTAGGACCCCTTCTGGGAGG - Intronic
1131618705 15:94044086-94044108 TTGTTAACACCCCTTTGGGGAGG + Intergenic
1136659881 16:31748561-31748583 TTTTTATTACCCATCTTGTGAGG + Intronic
1139227425 16:65246689-65246711 ATTTTGGTCCCACTTTTGGGAGG + Intergenic
1143608620 17:8004733-8004755 TTTCTAGTCCCCCTTTGTGGCGG - Intronic
1144499673 17:15774681-15774703 TTATTAATCCTCCTTTTGGGGGG + Intergenic
1149344593 17:55721722-55721744 TTTTTATTACCCACTTTAGGTGG + Intronic
1149882236 17:60304402-60304424 TTTCTTGTACCCCTTTTTGCTGG - Intronic
1150670328 17:67190617-67190639 TTTTCAGTGCCTCTTTTGGAGGG - Intronic
1150818717 17:68417356-68417378 TTTCTCCTACCCCTTTTGGAAGG + Intronic
1155365258 18:25043128-25043150 TTTTTGGTGACCCATTTGGGAGG + Intergenic
1155642382 18:28033789-28033811 TATTTAGTGCCCCTGTTGGCTGG - Intronic
1155722830 18:29039943-29039965 TTTTAATTACCCCTTTTAGTTGG - Intergenic
1157626391 18:49054737-49054759 TTGTAAGTGCCCCTCTTGGGTGG - Intronic
1158892612 18:61887200-61887222 CTTTTAGTTGCCCTTGTGGGAGG - Intronic
1166011367 19:39945158-39945180 CTTTAAGTTCCCCTTTGGGGTGG + Intergenic
1167246532 19:48376353-48376375 TTTTTAGAAACCCTTCTGGAGGG - Exonic
930732169 2:54738339-54738361 TTTTTTGTACCCCCTTTGACAGG + Intronic
931761408 2:65420345-65420367 TTTTTAGTACCCCTTTTGGGGGG + Intronic
932902394 2:75714480-75714502 TTATTAGTTTTCCTTTTGGGGGG - Intergenic
932923739 2:75946031-75946053 TTTTTCATACCTCTTTTGGCAGG - Intergenic
933066304 2:77802772-77802794 TTTTTAGTTCTCCTTTCTGGAGG + Intergenic
933201037 2:79449113-79449135 ATTTTAAAACCCCTTTTTGGGGG - Intronic
936370694 2:111899378-111899400 TTATTAGTATCCCTTTTTAGGGG + Intronic
936716562 2:115193639-115193661 TTCTAAGTACGCCTTTTGAGTGG - Intronic
940352611 2:152706033-152706055 TTCTAAGTACACCTTTTGAGTGG + Intronic
940378285 2:152983216-152983238 TTCTTAGTACCCCTTCTGTGTGG - Intergenic
940719004 2:157261044-157261066 TTTTTAGGATCCTTTTTGAGGGG - Intronic
940732839 2:157414034-157414056 TTTTAAGTATTCCTGTTGGGTGG + Intergenic
944906097 2:204263676-204263698 TTTTTAAAATCCTTTTTGGGTGG + Intergenic
945511556 2:210709246-210709268 TTTGTAGTTCCCATTTTTGGAGG + Intergenic
947533835 2:230928735-230928757 TTTTTAGGACCCCTTTTCCTTGG - Intronic
947759760 2:232595270-232595292 TTTTTAGCACTTTTTTTGGGCGG - Intergenic
1169157911 20:3349422-3349444 ATTTTAGCAACCCTGTTGGGAGG + Intronic
1170052203 20:12158570-12158592 TTTATAGTACACCTTTCAGGGGG + Intergenic
1171286895 20:23947243-23947265 TTTTTAGTAGCCATTTTGATTGG + Intergenic
1175233165 20:57488768-57488790 TTTTTTGTCTCCCCTTTGGGAGG + Intergenic
1177562322 21:22771864-22771886 TTTTTAATTCCCCTTTTGCTTGG + Intergenic
1179389305 21:40972970-40972992 TTTTTCATCCTCCTTTTGGGAGG + Intergenic
1181951976 22:26560763-26560785 TTTTTTGTCTCCCCTTTGGGAGG - Intronic
949871936 3:8596512-8596534 TTCTTAGTACCCCTCTGAGGTGG - Intergenic
951244430 3:20323922-20323944 TTTCTAGTTCCCATTTGGGGTGG + Intergenic
951412524 3:22382056-22382078 TTTTTTGTCTCCCCTTTGGGAGG - Intergenic
952093054 3:29914383-29914405 TTATTACTACCCTTCTTGGGTGG - Intronic
953401763 3:42628703-42628725 TTTTTAAAAGCCCTTTTGGCTGG + Intronic
954255652 3:49403966-49403988 TTTGTAGTACCTTTTTTCGGGGG - Intronic
954765375 3:52910783-52910805 TTTTTAAGAACCCTTTTGGCCGG - Intronic
959420233 3:106119285-106119307 TTTTTAGTACTCTTAGTGGGAGG + Intergenic
960659440 3:120041950-120041972 TTCTAAGTACACCTTTGGGGTGG + Intronic
965807016 3:172552188-172552210 TATTTAGTGCCCCTTCTGTGAGG + Intergenic
966071311 3:175882258-175882280 TTTTTAGTATTCCTTTTGATAGG - Intergenic
966215049 3:177493374-177493396 TTATTATTATCCCTGTTGGGAGG + Intergenic
970027741 4:11641382-11641404 TGGTTATTACCACTTTTGGGAGG - Intergenic
973864011 4:55093887-55093909 ATTTTAGTGCTCTTTTTGGGTGG - Intronic
975789878 4:77937517-77937539 TTTGTGGTCCCCATTTTGGGTGG + Intronic
976752025 4:88458262-88458284 TTTTTAGTGCATTTTTTGGGGGG + Intronic
980314083 4:131173859-131173881 TTTTGTGTACCCCTTATGGGAGG - Intergenic
981127310 4:141121402-141121424 TTATTACTACCCAGTTTGGGAGG - Intronic
981773760 4:148340844-148340866 TTTTTCATACACCTTTTGGTTGG - Intronic
982442427 4:155452686-155452708 TTTTTAATTCCCCATTTGTGTGG + Intergenic
982846393 4:160258356-160258378 ATTTTATTACACCATTTGGGAGG + Intergenic
984028913 4:174578921-174578943 CTTTTAGTACACCTTTAGAGAGG - Intergenic
986541402 5:8848327-8848349 TTTTTAAAACCACTTTAGGGGGG + Intergenic
987288103 5:16479951-16479973 TTTTTAATAACATTTTTGGGTGG + Intronic
988223022 5:28374242-28374264 GTTTTAGTTCTCTTTTTGGGGGG + Intergenic
990195655 5:53312055-53312077 TTTTTAAAACTCCTTTGGGGAGG + Intergenic
992403660 5:76434882-76434904 TTATTAGTAGCCATTTTGGCTGG + Intronic
995243634 5:109913082-109913104 TTTTCAGTAACTTTTTTGGGAGG - Intergenic
996601162 5:125265497-125265519 TTTTTTGTTTCCCTTTTAGGAGG - Intergenic
997376128 5:133398836-133398858 TCTTAAGGACCCCTTTTTGGTGG - Intronic
999832063 5:155330052-155330074 TTTTTATTACTTTTTTTGGGGGG - Intergenic
1000593949 5:163192538-163192560 TTTTTAGTCCCCTTTATGGCAGG + Intergenic
1003396673 6:5759292-5759314 CTTTTAATAGCCCTTTTGTGTGG + Intronic
1003949771 6:11106596-11106618 TTTTCAATACCCATGTTGGGTGG + Intronic
1004349824 6:14881223-14881245 TTTTTGGTATCCTTTTGGGGTGG + Intergenic
1005925969 6:30446044-30446066 TGTTCAGTACCTATTTTGGGGGG - Intergenic
1007730971 6:43946126-43946148 TTTTCAGTACTCCTATTGAGAGG - Intergenic
1011287293 6:85738712-85738734 TTTTTAGCACTCCTTTTTGGGGG - Intergenic
1011329737 6:86190453-86190475 TTTTTAGTCCACATTTTAGGTGG + Intergenic
1016502371 6:144735983-144736005 TTTTTAATACTACATTTGGGGGG + Intronic
1018452163 6:163919325-163919347 TTTTTAGTCCCCCTGTAGAGAGG - Intergenic
1020907486 7:14081809-14081831 TTTTGAATAATCCTTTTGGGTGG - Intergenic
1020954577 7:14725017-14725039 TTTTAATTACCCATTTGGGGTGG + Intronic
1022177830 7:27889129-27889151 TTTTTAAAAGCTCTTTTGGGTGG - Intronic
1028756258 7:94438094-94438116 TTTTTATTATCACTTTTGTGAGG + Intergenic
1031360211 7:120840303-120840325 TTTTCTGTATCCCATTTGGGTGG - Intronic
1033131701 7:138750770-138750792 TTTTAAGTGCCCCATTTAGGTGG + Intronic
1035704553 8:1665597-1665619 TTTTTACTACCCCTATTGCTGGG + Intronic
1038908187 8:31931312-31931334 TTTTTAGTTCCTCTTTTTTGGGG - Intronic
1042659909 8:71142958-71142980 TTTTATGTGCCCCTTTGGGGAGG - Intergenic
1043734896 8:83730297-83730319 TTTTTTTTTCTCCTTTTGGGAGG - Intergenic
1045820479 8:106330949-106330971 TTTTAACTACCATTTTTGGGGGG - Intronic
1049055207 8:140230927-140230949 CTTTTAGGACCCCTTTTAGGGGG + Intronic
1050169251 9:2798199-2798221 ATTTTAGTCGCCTTTTTGGGTGG - Intronic
1052332071 9:27280603-27280625 TTTTTTGCAGGCCTTTTGGGTGG - Intergenic
1053629721 9:39922999-39923021 TTATTAGTAAACCATTTGGGGGG + Intergenic
1053776043 9:41540548-41540570 TTATTAGTAAACCATTTGGGGGG - Intergenic
1054214166 9:62327703-62327725 TTATTAGTAAACCATTTGGGGGG - Intergenic
1054365686 9:64337945-64337967 TTATTAGTAAACCATTTGGGGGG + Intergenic
1054673318 9:67827656-67827678 TTATTAGTAAACCATTTGGGGGG + Intergenic
1059639751 9:116205075-116205097 TTTTTTTTCCCCCCTTTGGGTGG + Intronic
1059710593 9:116864433-116864455 TTTTGAGAACCTCATTTGGGAGG - Intronic
1060032008 9:120222757-120222779 TTGTCAGTACCATTTTTGGGGGG - Intergenic
1061692510 9:132345062-132345084 TGCTGAATACCCCTTTTGGGGGG - Intronic
1187372478 X:18721698-18721720 TTTTTATTACCCCATGTGGATGG + Intronic
1189621320 X:42842391-42842413 TTTTTAGTTTCCTTTTTTGGGGG + Intergenic
1191593104 X:62911317-62911339 TTGTTTGTACCCGTTTTTGGGGG + Intergenic
1193074853 X:77345078-77345100 TTTTTGTTATCCCTTTTAGGGGG + Intergenic
1194099186 X:89680827-89680849 TTTTTATTACCCCTTAATGGTGG + Intergenic
1198011301 X:132557850-132557872 TTTTCAATGTCCCTTTTGGGGGG - Intergenic
1198363298 X:135916700-135916722 TTTTTTGTATCCCCTTTGAGTGG + Intergenic
1200452201 Y:3342206-3342228 TTTTTATTACCCCTTAATGGTGG + Intergenic
1201056742 Y:10001233-10001255 TTTATAATAACCCTTTTGGTTGG + Intergenic