ID: 931762176

View in Genome Browser
Species Human (GRCh38)
Location 2:65427884-65427906
Sequence CTGTGAGTAACTGAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931762176_931762179 -10 Left 931762176 2:65427884-65427906 CCAGCTCCTTCAGTTACTCACAG 0: 1
1: 0
2: 0
3: 28
4: 275
Right 931762179 2:65427897-65427919 TTACTCACAGGATGACCTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 167
931762176_931762180 -5 Left 931762176 2:65427884-65427906 CCAGCTCCTTCAGTTACTCACAG 0: 1
1: 0
2: 0
3: 28
4: 275
Right 931762180 2:65427902-65427924 CACAGGATGACCTTGAGGAAAGG 0: 1
1: 0
2: 3
3: 21
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931762176 Original CRISPR CTGTGAGTAACTGAAGGAGC TGG (reversed) Intronic
900847710 1:5116905-5116927 GTGAGTGTAGCTGAAGGAGCCGG - Intergenic
902516274 1:16991399-16991421 CTGTGACAAGCTCAAGGAGCAGG - Intronic
904364886 1:30004055-30004077 CTGTGATTAAATTAAGGATCTGG + Intergenic
904631196 1:31843600-31843622 CTGGGATGAGCTGAAGGAGCTGG - Intergenic
905386695 1:37609371-37609393 CGGTGAGTTAAAGAAGGAGCAGG - Intergenic
906077155 1:43060522-43060544 CTGTGAGCAACTCAAGGACATGG - Intergenic
906598790 1:47105402-47105424 CTGAGACTAACATAAGGAGCCGG - Intronic
906802312 1:48748860-48748882 CTGTGAGTGAGGGCAGGAGCAGG + Intronic
906899544 1:49818974-49818996 CTGTTAGTAAATGATAGAGCTGG - Intronic
907546572 1:55265228-55265250 TTGTGAATAACTGAGGAAGCTGG + Intergenic
907924442 1:58942628-58942650 TTGTTAGAATCTGAAGGAGCTGG - Intergenic
908020226 1:59891140-59891162 CTGTGAGTAACTGAATTTTCTGG - Intergenic
908763000 1:67529468-67529490 CAATGAGTAACTGATGCAGCTGG - Intergenic
910006452 1:82403130-82403152 CTGTAAGGACCTGAAGGAGCCGG + Intergenic
910095762 1:83519888-83519910 TGGTGAGGAACTGAAGCAGCTGG - Intergenic
911377828 1:97073062-97073084 TAGTGAGTGATTGAAGGAGCAGG + Intergenic
911785293 1:101938733-101938755 CTGTAAGAAACTGAGGGAGTGGG - Intronic
915681152 1:157583093-157583115 CAGTGAGTAAGTTGAGGAGCTGG - Intronic
916325603 1:163556411-163556433 CTGTGATTAAGGGAAGGAGCAGG - Intergenic
918372397 1:183874244-183874266 CAGTGAATAAATGAAAGAGCTGG + Intronic
919150670 1:193693604-193693626 CTATTTGTATCTGAAGGAGCAGG + Intergenic
919542011 1:198859177-198859199 CTGTAAGTATCTGAAGGGGATGG + Intergenic
920494626 1:206446062-206446084 CTGTGATAAACTGGAGGAGAAGG - Exonic
920782318 1:209006000-209006022 CTGTGAATATTTGAAGGAGGAGG - Intergenic
921095678 1:211885365-211885387 CTGTGTGTGACTGAAGGAAGCGG - Intergenic
922431488 1:225559468-225559490 CTGTTAGTAACTGATGGAACAGG - Intronic
923284774 1:232483013-232483035 CTATGAGTATCTGAAATAGCAGG - Intronic
924497545 1:244604692-244604714 ATGGGAGTAACTGACGGAGAAGG + Intronic
1062953378 10:1522578-1522600 CACTGAGTGACAGAAGGAGCTGG - Intronic
1063070978 10:2664079-2664101 ATGTGAGGAACAGAAGGAGAAGG + Intergenic
1063325141 10:5092287-5092309 ATGTGAGTAACTTAAAGAACTGG - Intronic
1063416602 10:5878063-5878085 CTGTGACTGACTTAAGAAGCAGG + Intronic
1064388739 10:14922740-14922762 CTGTTAGTAAGTGGCGGAGCTGG + Intronic
1065145284 10:22762279-22762301 GTGTGGGTATCTGAGGGAGCAGG + Intergenic
1066476942 10:35756931-35756953 CTGTGAAGAACTGAAGGAGGGGG - Intergenic
1066558939 10:36647244-36647266 ATGTGATTAAGTGAAGGATCTGG + Intergenic
1067079809 10:43206469-43206491 CTGTGAACAACTGATGGGGCTGG + Intronic
1067730133 10:48804759-48804781 TTGTGAGTATCTGAGGGAGGGGG + Intronic
1068860775 10:61845770-61845792 CAGAGAGTAACTGAAGCAGCAGG + Intergenic
1069790322 10:71015119-71015141 CTGTAAGTAACTCAAGGAATTGG - Intergenic
1071550559 10:86563328-86563350 CTGAGTATAGCTGAAGGAGCTGG + Intergenic
1072449287 10:95526557-95526579 CTGTGAGTTTCTGAATCAGCAGG + Intronic
1073732984 10:106312632-106312654 CTGTGACTAACTGAATAAGAGGG + Intergenic
1074272062 10:111963883-111963905 CTGTGACTCCATGAAGGAGCCGG - Intergenic
1075923426 10:126232148-126232170 ATGTGATTACATGAAGGAGCTGG + Intronic
1077401866 11:2362831-2362853 CTGTGAGAGAGGGAAGGAGCAGG - Intergenic
1079338201 11:19589745-19589767 CTGGGAGCAGCTGAAGGAGATGG - Intronic
1079394085 11:20046495-20046517 TTTTGAGTAAAGGAAGGAGCTGG - Intronic
1079541891 11:21586560-21586582 CTGTGAGTGACTGAAACAGGTGG + Intergenic
1083579808 11:63817866-63817888 CTGTGAGGAGCCGAAGCAGCAGG + Exonic
1084421785 11:69064012-69064034 CTGTGACTAACAGAGGGGGCTGG + Intronic
1085669918 11:78453616-78453638 CTGTGAGAAACTGAATAAGGAGG - Intronic
1085767873 11:79299323-79299345 CAGCTAGTAACTGAAGGAGCCGG + Intronic
1086288526 11:85277615-85277637 CTGTGAGTAACTCACAGAGCTGG - Intronic
1086487275 11:87320275-87320297 CAGTTAGTAAATGAAGGAGCTGG + Intronic
1087013687 11:93536644-93536666 CTCTGAGGACCTGGAGGAGCTGG + Intronic
1088697881 11:112383898-112383920 ATTGGAGTAACTGAAGGAGATGG + Intergenic
1088738902 11:112750945-112750967 CTGTGAGAAGCTGAAGCCGCTGG + Intergenic
1088851970 11:113712082-113712104 CTGGAAGTAACTGCAGGAGTTGG + Intergenic
1089757792 11:120699120-120699142 CTGTGATGAACTGAAGCAGCTGG - Intronic
1091202692 11:133794260-133794282 CTGTTGGTAAGTGAAGGATCAGG - Intergenic
1091403143 12:193043-193065 CTGTGAGGAAGGGATGGAGCCGG + Intronic
1093522113 12:20063208-20063230 CCGTGAATAGCTGAAGGAGATGG - Intergenic
1096851834 12:54444578-54444600 ATTTGAATAGCTGAAGGAGCAGG - Intergenic
1100487137 12:95041141-95041163 CTTTGAAAAACTGAAAGAGCTGG - Intronic
1102090298 12:110181678-110181700 CTCTCAGTAACTGATGGAACAGG - Intronic
1102915032 12:116746263-116746285 CTCTGAGTAACTTCAGGTGCTGG + Intronic
1105009560 12:132746433-132746455 CTGTGAGTTAGGGAAGGAGGAGG - Intronic
1107247281 13:38311177-38311199 CTGAGACTAACTAAAGCAGCAGG + Intergenic
1108546892 13:51503887-51503909 ATTTGAGGAAATGAAGGAGCAGG + Intergenic
1109765240 13:66886740-66886762 GTGTGGGTATCTGAAGAAGCAGG + Intronic
1110365900 13:74685514-74685536 CTCTGAGTAACTTAAGAAACGGG + Intergenic
1111135944 13:84043670-84043692 CTCTGAGCAACTAAAGCAGCAGG + Intergenic
1111292501 13:86187057-86187079 CTGGGTGTACCTGGAGGAGCAGG - Intergenic
1112441056 13:99425569-99425591 CTGGGACTAACTCAAGGGGCAGG - Intergenic
1112942027 13:104875139-104875161 CACTGAGGAACTGAAGGAACAGG - Intergenic
1114648355 14:24268125-24268147 CTGTAAGGAGCTGCAGGAGCTGG - Exonic
1115108607 14:29791973-29791995 TGGTGAGTATCTGAAGGAACTGG - Intronic
1115495517 14:34000587-34000609 ATGTGAGGAATGGAAGGAGCCGG - Intronic
1115904203 14:38189016-38189038 CTGTGAGTTAAGGAAAGAGCTGG + Intergenic
1116460063 14:45162050-45162072 GCCTGAGCAACTGAAGGAGCTGG + Intronic
1116966726 14:51022643-51022665 ATTTGGGTAAATGAAGGAGCAGG + Intronic
1117523923 14:56578716-56578738 CTGTGAGTTCCTGGAGGAGAGGG - Intronic
1117965477 14:61203122-61203144 CAGTCAGTAACTGAAGGAACAGG - Intronic
1119872584 14:78029937-78029959 CTGTAATTAACTCAAGCAGCAGG + Intergenic
1119923678 14:78471516-78471538 CAGTAAGTAAATGAAGGAGAGGG - Intronic
1119923788 14:78472289-78472311 CTGTGAGGAACTTAAGGATCGGG + Intronic
1120586748 14:86321063-86321085 CTGTGTGGAAATGAAGGAGTTGG - Intergenic
1121971022 14:98355898-98355920 ATGTGATTAACTGAAGGATCTGG - Intergenic
1122233916 14:100321510-100321532 CTGTGTCTAACTGAAAGAACAGG - Intergenic
1122811116 14:104288585-104288607 CTGTGAGTGAATGACGGAGGGGG - Intergenic
1124507289 15:30289336-30289358 CTGTGAGTTCATGCAGGAGCTGG + Intergenic
1124736266 15:32249323-32249345 CTGTGAGTTCATGCAGGAGCTGG - Intergenic
1125472338 15:40016415-40016437 CTGTGTGCACCTGCAGGAGCAGG - Intronic
1126226774 15:46279991-46280013 ATGGGATTAAATGAAGGAGCTGG + Intergenic
1126248903 15:46543436-46543458 CTATCATTAACTTAAGGAGCAGG - Intergenic
1126844032 15:52742732-52742754 GTGAGAATAGCTGAAGGAGCCGG - Intergenic
1127612917 15:60654617-60654639 CTGTGATTAAATTAAGGATCTGG + Intronic
1127762670 15:62154268-62154290 CAGGTAGTAAGTGAAGGAGCTGG - Intergenic
1129911981 15:79235506-79235528 CTGTGAAAAACTGAAGGTACTGG - Intergenic
1132109364 15:99091178-99091200 CAGTGAGTAACTGAAGCCTCTGG - Intergenic
1133087600 16:3377129-3377151 CAGTGACTAAATGAAAGAGCTGG - Intronic
1135025180 16:18994148-18994170 CTGAGTATACCTGAAGGAGCTGG + Intronic
1137804766 16:51294512-51294534 CTGTGAGGAAGTAATGGAGCTGG - Intergenic
1138673824 16:58636576-58636598 CTGTGAGGAGCTGAAAGACCAGG + Intergenic
1141532605 16:84657212-84657234 CTGTGAGTACCTGGAGCAGGAGG + Exonic
1141873988 16:86809024-86809046 CTGTTAGTAACCGGAGCAGCAGG - Intergenic
1142196668 16:88742279-88742301 CTGTGAGTCGCTGAGGGGGCGGG - Exonic
1143458248 17:7081817-7081839 CTGCCAGTGACCGAAGGAGCTGG - Intergenic
1143480574 17:7225507-7225529 CTGTGGGTAACTGGAGGAGGAGG + Exonic
1145080441 17:19890549-19890571 CTGAGCATAGCTGAAGGAGCTGG + Intergenic
1146637039 17:34514206-34514228 ATGTGAGAAAATGAAGGAGACGG + Intergenic
1146647665 17:34585821-34585843 CTTTGAGCTACTGAAAGAGCTGG - Intronic
1147016324 17:37494611-37494633 ATGTGAGAAAGAGAAGGAGCAGG + Intronic
1149425396 17:56549968-56549990 CTGTAAGTAACAAAAGGAGAGGG - Intergenic
1149858016 17:60101820-60101842 CTGTGAGAAAATGAAGTAGTTGG - Intergenic
1151711394 17:75809027-75809049 ATGTGAGTACCTGCAGCAGCCGG - Intronic
1152259917 17:79261307-79261329 GTGTGAGTAAATGAAGGAGGGGG + Intronic
1153344773 18:4013381-4013403 CAGTTAGTAAGTGAAGGAGCTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1155026196 18:21943061-21943083 CTGCTAGTAAGTGATGGAGCCGG - Intergenic
1155103224 18:22634628-22634650 CTGGGAGCAGCTGAAGGAGGAGG - Intergenic
1155526083 18:26717418-26717440 CTGTGAGCAGCGGAAGCAGCAGG + Intergenic
1155962224 18:32004229-32004251 CTGAGTATAGCTGAAGGAGCTGG - Intergenic
1157204213 18:45684934-45684956 CTCTCAGGAACTGATGGAGCCGG - Intergenic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1160221212 18:76979391-76979413 CTGGGAGGAAGTGAATGAGCCGG + Intronic
1162915949 19:13874445-13874467 TTGTGAATTACTTAAGGAGCGGG + Intronic
1163418816 19:17202819-17202841 CTGTGAGGAACACAAGGAGGAGG - Intronic
1166003762 19:39893528-39893550 CTGTGGGCAGATGAAGGAGCAGG + Intronic
1166148282 19:40851954-40851976 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166152425 19:40883739-40883761 CAGGGAGTAAGTGAGGGAGCTGG + Intronic
1166177756 19:41086906-41086928 CAGGGAGTAAGTGAGGGAGCTGG - Intergenic
1166321130 19:42019586-42019608 CTGTGATTAAGTTAAGGATCTGG + Intronic
1166655515 19:44608528-44608550 TTGTGTGTCACTGAAAGAGCAGG - Intergenic
1166842746 19:45708685-45708707 CAGTGAGCAACTGCAGGAACTGG - Intergenic
1168093766 19:54102883-54102905 CTGCGAGTAAGTGCAGGTGCCGG + Exonic
925208660 2:2028116-2028138 CTGTGCTTGCCTGAAGGAGCAGG - Intronic
925737429 2:6976040-6976062 CTGGGAATAACTCAAGTAGCAGG - Intronic
926739174 2:16096956-16096978 GTGTCAGCAACTGATGGAGCTGG + Intergenic
927039955 2:19218931-19218953 CTGTGAGAGACTGAAGCAGAGGG - Intergenic
927097272 2:19757140-19757162 TTGTGAGGAAGTGATGGAGCAGG + Intergenic
928074102 2:28247282-28247304 CTGTGAGTTAGTGAGGGAGCAGG - Intronic
929141995 2:38674810-38674832 CTCTGAGTAACTGAAACTGCAGG - Intronic
930261674 2:49154245-49154267 CTGTGAGTATCAGAGGGAGGGGG - Exonic
931762176 2:65427884-65427906 CTGTGAGTAACTGAAGGAGCTGG - Intronic
932777158 2:74535275-74535297 CTGAGAGTGAGTGAAGGAGGGGG - Exonic
933468890 2:82694556-82694578 CTGAGAGTAGCTGAAGGAAGAGG - Intergenic
933692655 2:85191336-85191358 CTGTGCCTAACAGAAGAAGCTGG - Intronic
935375140 2:102388105-102388127 TTGTGAGAAACGGAAGGAGTGGG + Intronic
935640757 2:105287811-105287833 CTGTGAGTAATGGAGGGAGGTGG + Intronic
935699832 2:105801868-105801890 CTGAGAGAAAGTGATGGAGCTGG + Intronic
936021884 2:109001424-109001446 CAGGCAGTAACTGCAGGAGCTGG + Intergenic
937217180 2:120320202-120320224 CTCCAAGTAACTGAAGGAGAAGG + Intergenic
937227553 2:120378465-120378487 CTCTGGGTAACTGGAGGGGCAGG + Intergenic
937446244 2:121960935-121960957 CTGGCCGTAACTGAAGGTGCAGG + Intergenic
939338747 2:140865991-140866013 CAGTTAGTAAATGAAGGAGAAGG + Intronic
941444382 2:165582535-165582557 CCGGAAGAAACTGAAGGAGCTGG + Intronic
947419475 2:229929265-229929287 CTTTGAGAAACTAAAGGAGCTGG + Intronic
1169023474 20:2348081-2348103 ATGTGAACATCTGAAGGAGCAGG + Intergenic
1169072345 20:2740516-2740538 CTGTCAGTAACTCAAAGAGCTGG - Intronic
1170113669 20:12832959-12832981 CTGTGGGTAACCAATGGAGCTGG + Intergenic
1171006050 20:21466925-21466947 CAGTGTGTGACTGAAGTAGCTGG + Intergenic
1171941073 20:31330522-31330544 CTGTAAGGAAATGAAGAAGCAGG - Intergenic
1172590616 20:36115213-36115235 CTTTGAGTAAGTAAGGGAGCTGG + Intronic
1173279199 20:41612944-41612966 CTGAGAGTAACTCTAGGAGGTGG - Intronic
1174220370 20:48949563-48949585 GATGGAGTAACTGAAGGAGCAGG - Intronic
1174805857 20:53603940-53603962 GAGAGAGTAACTGAAGGAGGTGG - Intronic
1176206313 20:63890336-63890358 CTGTGAGTCAGGGAAGGAGGAGG - Exonic
1176732952 21:10518797-10518819 GAGAGAGTAACTGAAGGAGGTGG + Intergenic
1176908795 21:14537280-14537302 CTGGAAGAAAGTGAAGGAGCTGG - Intronic
1180813899 22:18777970-18777992 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
1181069159 22:20321583-20321605 CTGTGAGCCACAGCAGGAGCAGG + Intergenic
1181200084 22:21212305-21212327 CAGTGAGTAGATGAAGGAGCTGG + Intronic
1181701651 22:24624654-24624676 CAGCGAGTAGATGAAGGAGCTGG - Intronic
1182081001 22:27528702-27528724 CTGTGACTAAATGATGGGGCAGG + Intergenic
1183636539 22:39066833-39066855 GTGAGAACAACTGAAGGAGCTGG + Intronic
1184799881 22:46752890-46752912 CTGTGTGTATCTGCTGGAGCAGG - Intergenic
1185116304 22:48940153-48940175 CTGGGAGTGAATGAATGAGCAGG - Intergenic
1203226752 22_KI270731v1_random:82619-82641 CAGCGAGTAGATGAAGGAGCTGG - Intergenic
1203263998 22_KI270734v1_random:3657-3679 CAGCGAGTAGATGAAGGAGCTGG + Intergenic
950797255 3:15520314-15520336 GTGTGAGAAACAGAAGGAGGTGG - Intronic
952389045 3:32864392-32864414 GTGTGAGAAACTGAAGGTGGTGG + Intronic
952894935 3:38072220-38072242 GTGAGTGTAGCTGAAGGAGCCGG + Intronic
954051984 3:47987064-47987086 TTGTGAGAAACTGAGGGCGCAGG - Intronic
955377313 3:58408842-58408864 CCTGGAGTAAATGAAGGAGCAGG - Intronic
956028780 3:65013078-65013100 CTGTGGGTAACTGAAGCTCCAGG - Intergenic
956065835 3:65396181-65396203 CTGTGAGTAACTGGTTGAGAAGG + Intronic
958048636 3:88317727-88317749 CTATGAGCACCTGGAGGAGCTGG + Intergenic
958751267 3:98195087-98195109 GTGAGTATAACTGAAGGAGCTGG - Intronic
959671908 3:108987849-108987871 CTGTGAGAAGCTGGAGGAACAGG + Intronic
961567779 3:127775957-127775979 CAGTGAGTCACTGCAGCAGCTGG + Intronic
962049397 3:131796799-131796821 CTGTGGCTCACTGAAGCAGCTGG + Intronic
963320025 3:143801444-143801466 GTGAGTATAACTGAAGGAGCTGG - Intronic
964463565 3:156964709-156964731 CTGTGCAAAACTGAAGGAGATGG - Intronic
965496797 3:169408429-169408451 GTATGAGAAATTGAAGGAGCAGG - Intronic
966233899 3:177679632-177679654 CCGTGAGTAACTGCTGGGGCAGG + Intergenic
968412984 4:405296-405318 CTGAGTATAGCTGAAGGAGCTGG + Intergenic
968680975 4:1919467-1919489 CTGTAAAGAACTGAAGGAGTTGG + Intronic
968963352 4:3756859-3756881 CTGTGAGTAAGTCAAGGTACAGG - Intergenic
969321096 4:6413392-6413414 CCCTGAGTAGCTGAAGGAACAGG - Intronic
969676744 4:8618593-8618615 CTGTGAGTGCCTGAGGGTGCCGG - Intronic
969683589 4:8656732-8656754 CTGTGAGTTCCTCATGGAGCGGG + Intergenic
971695880 4:29902348-29902370 CTGTGGATAACTGAAGGAGTGGG + Intergenic
971814679 4:31471997-31472019 CTGGGACTAACTGGAGGAGCTGG - Intergenic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
973262516 4:48179076-48179098 CTGTGAGAAACTGAAGGGAAGGG - Intronic
975284645 4:72603272-72603294 CTGTTAGTTCCTGAAAGAGCTGG - Intergenic
976521196 4:86029187-86029209 GAGTGAGTACCTGAAGGAGAAGG + Exonic
976933849 4:90603781-90603803 CAGGGAGTAACTGTAGGAGAAGG + Intronic
977415805 4:96731891-96731913 CTGTTACTAACTGAGGGACCTGG + Intergenic
979131875 4:117057285-117057307 CTGTTAGAAAGTCAAGGAGCTGG + Intergenic
980221830 4:129927984-129928006 CCATGAGTAACTGAAGCAGTCGG - Intergenic
984432454 4:179665788-179665810 CATAGAGTAACTGAAGAAGCAGG - Intergenic
984502244 4:180571049-180571071 TAGAGAGTAACTTAAGGAGCTGG - Intergenic
984671128 4:182488896-182488918 GGGTGAGGAACTGAAGGACCTGG + Intronic
985323322 4:188738742-188738764 CTGGAAGTAACTGCAGGAGTTGG + Intergenic
985386998 4:189458552-189458574 CACTCAGTAAGTGAAGGAGCTGG - Intergenic
985841621 5:2310157-2310179 CAGTGTGAACCTGAAGGAGCTGG + Intergenic
986125961 5:4882546-4882568 CTGTGAGTTTCTGCAGGACCTGG - Intergenic
986128318 5:4904363-4904385 CTGTGAGGAACTGATGCAGGCGG - Intergenic
990282271 5:54263987-54264009 CTGTGATATACTGAAGGAGTTGG - Intronic
990453992 5:55966361-55966383 CTGGGATTGACTGAAGGAGCAGG + Intronic
991295243 5:65073548-65073570 CTGTGAGAAAAGAAAGGAGCGGG - Intergenic
992026242 5:72672190-72672212 AAGGGAGCAACTGAAGGAGCAGG + Intergenic
992116387 5:73542278-73542300 CTGTGAATAACTTCAGGATCAGG - Intergenic
992499201 5:77325062-77325084 CTGTAACCAACTGGAGGAGCTGG + Intronic
994412794 5:99430469-99430491 CTGTAAGTACCTGAGTGAGCAGG - Intergenic
994481047 5:100335254-100335276 CTGTAAGTACCTGAGTGAGCAGG + Intergenic
994884772 5:105546162-105546184 CTTTGAGTAACCCAAGGAGTAGG - Intergenic
996817490 5:127589828-127589850 CTGGGAGGAACTGGAGGAGCCGG - Intergenic
996891472 5:128426321-128426343 CTCTGAGTAACTTAAGGAAAAGG - Intronic
998302119 5:141032829-141032851 CTGAGACTAACTGTAGGGGCAGG - Intergenic
999089607 5:148924650-148924672 CTGTTAGTAAGTAATGGAGCTGG + Intronic
1000702484 5:164470263-164470285 CTGGGTGCAACTGAAGGAGGAGG + Intergenic
1002860914 6:1078651-1078673 TTTTGAGTAACCAAAGGAGCAGG - Intergenic
1002929248 6:1622056-1622078 CCCTGAGTAATGGAAGGAGCGGG - Intergenic
1006106169 6:31718321-31718343 CTGAGAGAAACTGAAGAAACAGG + Intergenic
1010825759 6:80472357-80472379 CTGAGAGTAACTAAAAAAGCTGG + Intergenic
1012616643 6:101285644-101285666 CTGTGATTAAGTTAAGGAACAGG + Intergenic
1013849070 6:114492055-114492077 CAGTCAGTAATTTAAGGAGCAGG - Intergenic
1014211023 6:118708202-118708224 CTGTGAGTAACTTAAGGGCAGGG - Intronic
1016047858 6:139498756-139498778 TTGTTAGTAAGTGATGGAGCTGG - Intergenic
1017312930 6:152995246-152995268 CTGGAAGTAACTGCAGGAGTTGG - Exonic
1017697852 6:157036666-157036688 CTGTGAGTATCTTCAAGAGCTGG - Intronic
1017792852 6:157816798-157816820 CCGTGATTAACTGGAGTAGCAGG - Intronic
1018113342 6:160558366-160558388 CTGTGAGTAAATAAAGGGGCTGG - Intronic
1018376552 6:163218687-163218709 CTGGGAGGAGCTGGAGGAGCAGG - Intronic
1020418184 7:7969370-7969392 CTGAGAGGAACTGGAGGAGGAGG - Exonic
1020911669 7:14139282-14139304 CTGTGAAAACCTGAATGAGCTGG + Intergenic
1025009012 7:55380664-55380686 CAGTGAGTAATTGGAGGAGGAGG + Intronic
1026033964 7:66817665-66817687 CAGGGAGTAACAGGAGGAGCTGG + Intergenic
1026177610 7:68011789-68011811 CTGAGAGTAACTAAAGGAGATGG + Intergenic
1026808716 7:73444394-73444416 CTGGGAGTAACTGCAGGACGGGG - Intronic
1026985628 7:74553692-74553714 CAGGGAGTAACAGGAGGAGCTGG - Intronic
1027263719 7:76482623-76482645 CTGTGACTATCTGGAGCAGCAGG + Exonic
1028103302 7:86847812-86847834 GTGTGACTTACTGAAGGAACTGG + Intronic
1030900262 7:115114819-115114841 CTGGGAAGAACGGAAGGAGCGGG - Intergenic
1033127566 7:138718807-138718829 CTGTGAGGAATTGAAGGGACAGG + Intronic
1037995257 8:23347723-23347745 CTTTGAGAAACTGAAGCAGGAGG + Intronic
1038023768 8:23571492-23571514 CTATGAGTTCCTGCAGGAGCAGG + Exonic
1038037294 8:23697081-23697103 CTGTGAGTTAGTGATGGAACTGG - Intergenic
1038215081 8:25554623-25554645 ATGTGATTAAATGAAGGACCTGG + Intergenic
1038557137 8:28530310-28530332 CTATGAGGAACTGAAGCAGAGGG - Intronic
1038852879 8:31297233-31297255 CTGTGAGAAAATTAAGGAGTTGG + Intergenic
1041651579 8:60308215-60308237 GTGAGTATAACTGAAGGAGCTGG + Intergenic
1042026244 8:64426992-64427014 CTGTGAGTAACTGAGCCAACTGG - Intergenic
1045526688 8:102946434-102946456 CAGTGGGTAACTCCAGGAGCAGG + Intronic
1046413064 8:113874430-113874452 CTGTGAGTATCTGGTGGATCTGG - Intergenic
1047864303 8:129004875-129004897 CTGGGAGAAATTGAAGGAGAGGG + Intergenic
1047931145 8:129729113-129729135 CTGCAAGTAACTGCAGGAGTTGG + Intergenic
1050303006 9:4277850-4277872 CAATGAGTAACTGTTGGAGCAGG + Intronic
1051539320 9:18196757-18196779 GTGTGAGGAACTGAAGGACTAGG - Intergenic
1057535956 9:95906608-95906630 CTGAGAGTATCTGAAAGAGGGGG + Intronic
1057874724 9:98745233-98745255 CAGTGAATAAGTGAAGGAGCTGG + Intronic
1058382557 9:104393759-104393781 CAGCAAGTAAGTGAAGGAGCAGG + Intergenic
1059948443 9:119437295-119437317 CAGTGATTCACTGAAGTAGCTGG + Intergenic
1060085104 9:120691717-120691739 CAGGGAGTAAGTGATGGAGCTGG + Intronic
1060526837 9:124325641-124325663 CTGTAAGTAACAGAAGGTCCTGG - Intronic
1060768674 9:126314474-126314496 CTGTCAGGACCTGTAGGAGCCGG + Intergenic
1061405256 9:130390275-130390297 CTGTGAGCCCCTGATGGAGCCGG - Intronic
1061676462 9:132218905-132218927 CTGTGAGTGAATGAATGATCGGG - Intronic
1061724512 9:132574779-132574801 CTGTGAGTGACTGAGGGACTGGG + Intergenic
1062171753 9:135138606-135138628 CTGAGAGAACCTGCAGGAGCAGG - Intergenic
1186198285 X:7131383-7131405 ATGTGATTAAGTGAAGGATCTGG + Intronic
1186573496 X:10740571-10740593 CTGCAAGTAAATGATGGAGCAGG - Intronic
1187065449 X:15832591-15832613 CTGTGAGAAAATGAAGTAGTTGG - Intronic
1188621608 X:32232446-32232468 CTGTATGTAACTGTGGGAGCAGG + Intronic
1190624476 X:52323616-52323638 CAGTTAGTAAGTGATGGAGCTGG - Intergenic
1191961898 X:66712745-66712767 CTGTGAGTATGTGAAGGTACTGG - Intergenic
1195568072 X:106365829-106365851 ATGTGATTAAATGAATGAGCAGG + Intergenic
1195916361 X:109940049-109940071 TTGGGAGTAACTGAGTGAGCTGG + Intergenic
1196165771 X:112534395-112534417 GTGAGTGTAGCTGAAGGAGCCGG - Intergenic
1197765497 X:130057144-130057166 CTGTGAGTCTCAGAAGGGGCAGG - Exonic
1198329325 X:135607220-135607242 CTGTGAGTGACTGCAGCATCTGG - Intergenic
1198361978 X:135904473-135904495 CTGTGAGTGACTGCAGCATCTGG - Exonic
1198428228 X:136540863-136540885 CTGTTAGTAAGTGATGGAGCTGG - Intronic
1200115111 X:153766495-153766517 CTGTGAGTCACAGAGGGGGCAGG - Intronic
1201061468 Y:10050405-10050427 CTGAGTATAGCTGAAGGAGCTGG + Intergenic
1201573507 Y:15438291-15438313 ATGTGATTAAATGAAGGATCTGG + Intergenic
1202166690 Y:21996659-21996681 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202224669 Y:22589714-22589736 CAGTGAGTAACTGAGTAAGCAGG - Intergenic
1202318445 Y:23605946-23605968 CAGTGAGTAACTGAGTAAGCAGG + Intergenic
1202552322 Y:26064111-26064133 CAGTGAGTAACTGAGTAAGCAGG - Intergenic