ID: 931762451

View in Genome Browser
Species Human (GRCh38)
Location 2:65430662-65430684
Sequence CCCCGCGCGCGTCTTTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931762451_931762459 3 Left 931762451 2:65430662-65430684 CCCCTGCAAAGACGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 931762459 2:65430688-65430710 CCCTCCAGGGCGCGTCCCCGCGG 0: 1
1: 0
2: 1
3: 14
4: 126
931762451_931762456 -10 Left 931762451 2:65430662-65430684 CCCCTGCAAAGACGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931762451 Original CRISPR CCCCGCGCGCGTCTTTGCAG GGG (reversed) Intronic
900428371 1:2590759-2590781 CCCCGCGGGTGTCTGTGGAGGGG + Exonic
900605275 1:3521083-3521105 CCCCGCCTGGGGCTTTGCAGGGG - Intronic
904511107 1:31008883-31008905 CACCGCGCCCGGCCTTGCAGGGG - Intronic
904697151 1:32336921-32336943 CCCCACGTGGGACTTTGCAGTGG - Intergenic
906345355 1:45011182-45011204 CCGCGTGCGCTTCTTGGCAGAGG - Exonic
913959291 1:143326854-143326876 GCCCGCCCGCGTCTCTGCTGAGG + Intergenic
916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG + Exonic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
1064120949 10:12618523-12618545 CCCCCCACGAGTCTTTGAAGGGG - Intronic
1065588257 10:27240906-27240928 GACCGCGCGCGTCCTTGCCGCGG - Intronic
1081872165 11:46388143-46388165 GCCCGCGTGCGTCTGTGGAGCGG - Intergenic
1084265729 11:68004201-68004223 GCGCGCGCGCGTGTGTGCAGGGG + Intronic
1096478570 12:51923500-51923522 CCCCGCGGGGGTCTGAGCAGGGG - Intergenic
1101232657 12:102756969-102756991 CCCCCCGGGAGACTTTGCAGGGG - Intergenic
1107078257 13:36346516-36346538 CCACGCGCGCGTCTTGCCAGCGG + Intronic
1121137303 14:91510294-91510316 CCCCGCGCGCCGCTTTTGAGGGG - Intronic
1124500332 15:30222987-30223009 CCCCGCGCGCGTCCATGGCGAGG - Intergenic
1124743241 15:32315679-32315701 CCCCGCGCGCGTCCATGGCGAGG + Intergenic
1142206614 16:88785774-88785796 CACCGCGCGCGGCTTTGCCCGGG + Intergenic
1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG + Exonic
1152568387 17:81110542-81110564 CCCGGCGTGCGTCTTTGCCGTGG + Intronic
1160702175 19:512926-512948 ACCCGCGCGGCTCTTGGCAGCGG - Intronic
1160719141 19:589939-589961 CCCCGCGCGCGTCCATGGCGAGG - Exonic
1164828380 19:31301197-31301219 CACCACCCGCTTCTTTGCAGAGG - Intronic
1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG + Exonic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
1175306930 20:57982647-57982669 CACCGGGTGCTTCTTTGCAGAGG + Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180014564 21:45074068-45074090 CCCCGCGCTCCTCCCTGCAGCGG - Intronic
1182598816 22:31443697-31443719 CCCCACGTGGGTCTTTGCACCGG - Intronic
952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG + Intronic
952990878 3:38829679-38829701 CCCCATGCGCTGCTTTGCAGAGG - Intergenic
962897366 3:139728431-139728453 CCCCTTGCGCATCTCTGCAGGGG - Intergenic
966696409 3:182793907-182793929 CCCCGCGCCCGTCTCCGCTGCGG - Intronic
969279082 4:6157314-6157336 TCCCGTGCGCCTTTTTGCAGAGG - Intronic
971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG + Exonic
971216490 4:24666574-24666596 CCCCTCGTGCATCTGTGCAGGGG + Intergenic
978621340 4:110637111-110637133 GCCCGCGCGCCACTGTGCAGTGG - Intronic
982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG + Intergenic
1006367058 6:33621934-33621956 TCCCGCGCACGCCTTTGGAGGGG + Intronic
1016400400 6:143673809-143673831 CCCTGCGTGAGTCTCTGCAGAGG - Intronic
1042244518 8:66697314-66697336 CACCGCGCCCGGCCTTGCAGGGG - Intronic
1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG + Intronic