ID: 931762456

View in Genome Browser
Species Human (GRCh38)
Location 2:65430675-65430697
Sequence GCGCGCGGGGCCTCCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931762446_931762456 4 Left 931762446 2:65430648-65430670 CCGAAGCCCACACTCCCCTGCAA 0: 1
1: 0
2: 3
3: 22
4: 309
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762444_931762456 18 Left 931762444 2:65430634-65430656 CCGGAGCACGCCTTCCGAAGCCC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762442_931762456 28 Left 931762442 2:65430624-65430646 CCTGGGGCCTCCGGAGCACGCCT 0: 1
1: 0
2: 1
3: 10
4: 164
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762447_931762456 -2 Left 931762447 2:65430654-65430676 CCCACACTCCCCTGCAAAGACGC 0: 1
1: 0
2: 1
3: 9
4: 127
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762443_931762456 21 Left 931762443 2:65430631-65430653 CCTCCGGAGCACGCCTTCCGAAG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762445_931762456 8 Left 931762445 2:65430644-65430666 CCTTCCGAAGCCCACACTCCCCT 0: 1
1: 0
2: 4
3: 20
4: 255
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762451_931762456 -10 Left 931762451 2:65430662-65430684 CCCCTGCAAAGACGCGCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110
931762448_931762456 -3 Left 931762448 2:65430655-65430677 CCACACTCCCCTGCAAAGACGCG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931762456 Original CRISPR GCGCGCGGGGCCTCCCTCCA GGG Intronic
900254658 1:1691777-1691799 GGGCACAGGGCGTCCCTCCACGG - Intronic
900263410 1:1745052-1745074 GGGCACAGGGCGTCCCTCCACGG - Intronic
900522757 1:3113550-3113572 GCGGGAGGGGCCTGCGTCCATGG + Intronic
901604750 1:10450288-10450310 GCCGGTGGGGCCACCCTCCAGGG - Exonic
902600973 1:17539963-17539985 GCGCGGGGGCCCTGCCTCCGCGG + Intronic
904046927 1:27614751-27614773 GGGGGCGGGGCCGCCCTCCCAGG + Intronic
904050183 1:27634200-27634222 GCCCGCAGGGGCTGCCTCCAAGG - Intronic
905892061 1:41523877-41523899 GAGCCCTGGGTCTCCCTCCAAGG + Intronic
906204459 1:43979523-43979545 GCGCGCGCGGCCCCCACCCAGGG + Intronic
906747950 1:48234760-48234782 CCTAGCTGGGCCTCCCTCCATGG - Intronic
906950928 1:50333830-50333852 GAGCGCGGGGTCTCCCCCGAGGG - Intergenic
908354464 1:63317194-63317216 GCGCGCGGGGCAGACCTCCTCGG - Intergenic
908942297 1:69450081-69450103 GTGCCCGGTGCCTGCCTCCACGG - Intergenic
913972208 1:143423860-143423882 GAGGGCGGAGCCTCCCTCCAAGG + Intergenic
914066589 1:144249473-144249495 GAGGGCGGAGCCTCCCTCCAAGG + Intergenic
914112564 1:144716881-144716903 GAGGGCGGAGCCTCCCTCCAAGG - Intergenic
921603910 1:217135191-217135213 GCGCGCGGGGCAGCCCTCTAGGG + Intronic
922470650 1:225875124-225875146 GCCTGCGGGGCCTGCCTTCAGGG - Intronic
924052777 1:240093590-240093612 GTGCGCGGAGCCTCCCACCCGGG - Exonic
1067703287 10:48588899-48588921 TGGCCTGGGGCCTCCCTCCACGG - Intronic
1072757389 10:98030249-98030271 GCGCGCGGAGCCTCCCCCGCGGG - Intronic
1072891560 10:99329554-99329576 GCGCAGGGTGCCCCCCTCCAGGG - Exonic
1075420929 10:122299741-122299763 GCGCTATGGGCCTCGCTCCATGG + Intronic
1077037927 11:504201-504223 GGGCGCGGGGCCACCCTCTAGGG + Intronic
1077102359 11:827849-827871 GGGGGCGGGGCGTCCCTGCAAGG + Intronic
1077307652 11:1875173-1875195 GAGGGCGGAGCCTCCCTCCACGG - Intronic
1084285571 11:68128522-68128544 GCGGGCGGGGCCTCGCGCGAGGG + Intergenic
1084694734 11:70746566-70746588 GAAGGCTGGGCCTCCCTCCAGGG + Intronic
1103927140 12:124429366-124429388 GCGCCAGGGCCCTCCCTGCAGGG + Intronic
1104761357 12:131299100-131299122 CCGCCCTGGGCCTCCCTCCCCGG - Intergenic
1104818418 12:131661692-131661714 CCGCCCTGGGCCTCCCTCCCCGG + Intergenic
1104900468 12:132187339-132187361 GCGCGTGGCTCCTCCCTCCGGGG - Intergenic
1112494750 13:99895983-99896005 GCCCGCGGGGCCGCCCACCCCGG - Exonic
1112508603 13:99989930-99989952 GCGCGCTAGGCCTGCTTCCAAGG + Intergenic
1117920748 14:60723596-60723618 GCGCTCGTGGCCTTCCACCAGGG - Exonic
1119771892 14:77225300-77225322 GCGTCCGGGGCCTCCTTCCTGGG - Intronic
1122387538 14:101359305-101359327 GCCTGAGGGGCCTCCCTCCATGG - Intergenic
1123007070 14:105329086-105329108 GGGCGCAGGGCCAGCCTCCAGGG - Intronic
1125371987 15:38987713-38987735 GCCCCCGATGCCTCCCTCCAAGG + Intergenic
1126163476 15:45634780-45634802 GCCTGCGGGGCCGCCCTTCAGGG + Exonic
1128841736 15:70855853-70855875 GCCAGCTGTGCCTCCCTCCAGGG + Intronic
1129387623 15:75204440-75204462 GCCCCTGGGGCCTCCCTCCCTGG + Intronic
1132527885 16:426392-426414 GCTCGCGGGGCCACACTCCTCGG - Exonic
1132690257 16:1178884-1178906 GGGCGCGGGGCCACCCTGCTGGG - Intronic
1136555671 16:31006475-31006497 GCGAGGAGGGCCTGCCTCCAGGG + Intronic
1141830681 16:86508601-86508623 GGGCGCGGCCTCTCCCTCCAGGG - Intergenic
1142763991 17:2055861-2055883 GGGCCCGGCGCCTCCCTCCGCGG - Intronic
1147200605 17:38799223-38799245 GCGCGCGGGGCCGCGCTCAGAGG + Intronic
1148093041 17:45034142-45034164 GGGGGCGGGGCCTCCTTCCAGGG - Intronic
1152503485 17:80729844-80729866 CGCCGCGGGGCCTCCCTCCATGG - Intronic
1152526317 17:80890091-80890113 GCGCACGGGGCCTCCCTCGGGGG - Intronic
1152925472 17:83085668-83085690 CCGAGCGGGGCCTCTCTCCCTGG + Intronic
1157520449 18:48341891-48341913 TGGTGGGGGGCCTCCCTCCAAGG + Intronic
1157858718 18:51122871-51122893 GCAGGCTGGGCCTCCATCCATGG + Intergenic
1160791327 19:925108-925130 GTGCCCCGCGCCTCCCTCCAGGG - Intergenic
1160831951 19:1108330-1108352 GCACGCGGGGCCGCCCTCCGAGG - Exonic
1161323442 19:3651852-3651874 GCGCGCGGCGCCACCCTGGATGG + Exonic
1161609860 19:5236484-5236506 TCTCTCTGGGCCTCCCTCCAGGG - Intronic
1162558000 19:11399702-11399724 GCGCCCGGGGTATCCATCCAGGG - Intronic
1163433405 19:17281809-17281831 GCTCGGGGGGCCCCTCTCCAGGG - Exonic
1163712492 19:18855055-18855077 GCGCGCGGGGCCTCGCCCATGGG + Intronic
1167050061 19:47072525-47072547 GGGCGGGGGGCCACCCTGCATGG + Exonic
1167383291 19:49150546-49150568 GGGGGCGGGGCTTCCCTCCCGGG + Exonic
1168241819 19:55092520-55092542 GGCCGAGGGGCCGCCCTCCAGGG + Exonic
931762456 2:65430675-65430697 GCGCGCGGGGCCTCCCTCCAGGG + Intronic
932699827 2:73984997-73985019 GCGCGCGGAGCCCCCCGCCCGGG - Intergenic
934176900 2:89584797-89584819 GAGAGCGGAGCCTCCCTCCAAGG + Intergenic
934287207 2:91659157-91659179 GAGAGCGGAGCCTCCCTCCAAGG + Intergenic
935595080 2:104872157-104872179 GGGCGCAGGGCATCCCTGCAGGG - Intergenic
936083463 2:109451003-109451025 GGGAGCAGGGCCTGCCTCCAGGG - Intronic
937931036 2:127205369-127205391 GCGCCCTGGGCCTCCCTGCCTGG + Intronic
947625289 2:231614802-231614824 GCGCGCGGGTTCCCCCTCCTTGG - Intergenic
1168965211 20:1894652-1894674 GCTCGCGGGGCCGCCTTCCCGGG + Intronic
1169081639 20:2800748-2800770 GCGAGCGGGGCTGACCTCCAAGG + Intergenic
1170582726 20:17711254-17711276 TCCCCCGGGGCCCCCCTCCAGGG + Intronic
1173058074 20:39635753-39635775 TTGCGCTGTGCCTCCCTCCAGGG + Intergenic
1174040336 20:47694749-47694771 CCGCACCGGGCTTCCCTCCAAGG + Intronic
1175422184 20:58841424-58841446 GCGCGCGTGACTTCCCTCCCGGG - Intronic
1175518337 20:59583537-59583559 ACGCGGGGAGCCTCCCTCCTGGG - Intronic
1176555546 21:8252762-8252784 ACGCGCGGGGCCTCACGCCCCGG - Intergenic
1179766179 21:43574740-43574762 GCACACAGGGCCGCCCTCCATGG + Intronic
1179839748 21:44063717-44063739 GCGCGCTGGGCCACCTCCCACGG - Exonic
1180078704 21:45476186-45476208 GCGCGAGGGGCTTCCTTCCGTGG - Intronic
1180733822 22:18001231-18001253 GCGCGCCGAGCCTCCCGCCCGGG - Intronic
1182278114 22:29203008-29203030 GCGGGCGGGGCCTCCCCCCTGGG - Intergenic
1182583361 22:31328490-31328512 GGGCCCGGGGCATCCCTGCAGGG + Intronic
1184294430 22:43514917-43514939 GCGCCCCGGGCCTCCCCGCAGGG - Intergenic
1184640204 22:45866587-45866609 CCGCGCGGGGCCGAGCTCCACGG + Intergenic
1184698197 22:46151026-46151048 GCCCGTGGGCCCTCCCTCCGAGG - Intronic
1185182865 22:49373108-49373130 GCACTCTGGGCCTCCCTCCTTGG - Intergenic
953385294 3:42502699-42502721 CCGCGCGGGGCCGCCCGCCGCGG + Exonic
954539073 3:51381922-51381944 GAGCCCAGGCCCTCCCTCCAGGG + Exonic
960101179 3:113745618-113745640 GCGCCCGGGGCCTCCTTCCCGGG - Intronic
965590397 3:170356898-170356920 CCCCGCGGGACCTCCCTCCTGGG - Intergenic
968654875 4:1774122-1774144 GCCCGGGGGGCCTCTCTCCGAGG - Intergenic
968664118 4:1811305-1811327 GAGTGCTGGGCCGCCCTCCATGG - Intergenic
968986794 4:3880056-3880078 GCGGGAGGGGCCTCCCTGCGTGG + Intergenic
969716669 4:8871324-8871346 GCGCGCTGGGCCTCGGTCCTCGG - Exonic
978361109 4:107931807-107931829 GGGCGCGGGGCATCCCGCCCGGG + Exonic
982468612 4:155759901-155759923 GCGCGGGGGGCCTCCCACACTGG - Intronic
985779043 5:1860266-1860288 GCTCGCGGGGCCTCGCTGCAGGG + Intergenic
985997007 5:3602664-3602686 GCGCGTGGGGACTCCGTGCATGG + Intergenic
1001617921 5:173057081-173057103 GGGCGAGGGGCCTCCCTCCCGGG + Intronic
1002374967 5:178782132-178782154 GTGACAGGGGCCTCCCTCCAAGG + Intergenic
1004533528 6:16477249-16477271 GAGCTGGGGGCTTCCCTCCATGG - Intronic
1010059452 6:71605866-71605888 GCATGTTGGGCCTCCCTCCAGGG + Intergenic
1015910155 6:138161779-138161801 GCCCGCGGGGCCTGCCTCGGCGG + Intergenic
1019484222 7:1281259-1281281 GCGTGTGGGGCCTCCTTCCAGGG - Intergenic
1025959068 7:66205023-66205045 GCGCGCGTGGCCTGGCTGCAGGG - Intergenic
1026772230 7:73209813-73209835 TCCCGCAGGACCTCCCTCCAGGG - Intergenic
1027013099 7:74763206-74763228 TCCCGCAGGACCTCCCTCCAGGG - Intergenic
1027074942 7:75182828-75182850 TCCCGCAGGACCTCCCTCCAGGG + Intergenic
1029832854 7:103279789-103279811 GCGCGATGCGCCTCCCTCCTAGG + Intergenic
1032761502 7:134947511-134947533 CCACGCTGGCCCTCCCTCCAGGG - Exonic
1034163977 7:149011960-149011982 GCAGTCCGGGCCTCCCTCCAAGG - Exonic
1044857719 8:96493734-96493756 CCGCGCCGCGCCTCCCTCCCCGG - Exonic
1048856836 8:138693588-138693610 CTGGGCGGGGCCTCCCTCCGGGG + Intronic
1049614870 8:143571742-143571764 ACTCGCAGGGCCGCCCTCCAGGG + Exonic
1055508468 9:76971264-76971286 GCCAGGGGGGCCTGCCTCCAGGG - Intergenic
1057773378 9:97985140-97985162 CCCCGCGGGGCCGCCCTCCGCGG - Intronic
1060161624 9:121370077-121370099 GCGGGCGGGGGCTCGGTCCACGG + Intronic
1061975871 9:134067851-134067873 GCGCTCGGGGCCGCGCTCCCCGG + Intronic
1062494531 9:136825479-136825501 GGGCACGGCCCCTCCCTCCAGGG - Intronic
1062717926 9:138020496-138020518 GCGTGCCGGGCCTCTCTGCATGG - Intronic
1185890688 X:3819379-3819401 CCGCGCCCGGCCTCCCTCAAGGG - Intronic
1189179372 X:38988773-38988795 GCGCGCCCGGCCTTCCCCCAGGG - Intergenic
1189331263 X:40146262-40146284 GAGCCCGGTGCCTCCCCCCACGG + Intronic
1192965602 X:76173521-76173543 GGGCGCGGTGGCTCCCCCCAAGG - Intronic
1197750616 X:129961334-129961356 GCTAGTGGGGCCGCCCTCCAGGG - Intergenic